Incidental Mutation 'R0116:Apob'
ID20827
Institutional Source Beutler Lab
Gene Symbol Apob
Ensembl Gene ENSMUSG00000020609
Gene Nameapolipoprotein B
Synonymsapob-100, apob-48
MMRRC Submission 038402-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R0116 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location7977648-8016835 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 7989113 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811] [ENSMUST00000171271]
Predicted Effect probably benign
Transcript: ENSMUST00000037520
SMART Domains Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 33 585 6.03e-94 SMART
DUF1943 619 932 7.88e-97 SMART
Pfam:DUF1081 945 1059 9.4e-32 PFAM
low complexity region 1100 1109 N/A INTRINSIC
Blast:LPD_N 1249 1311 9e-22 BLAST
low complexity region 1632 1644 N/A INTRINSIC
internal_repeat_1 1882 2038 6.61e-9 PROSPERO
SCOP:d1gw5a_ 2105 2577 9e-5 SMART
internal_repeat_1 2973 3150 6.61e-9 PROSPERO
low complexity region 3561 3580 N/A INTRINSIC
low complexity region 3928 3936 N/A INTRINSIC
Pfam:ApoB100_C 4401 4456 5.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037811
SMART Domains Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 46 598 6.03e-94 SMART
DUF1943 632 945 7.88e-97 SMART
Pfam:DUF1081 960 1070 6.3e-39 PFAM
low complexity region 1113 1122 N/A INTRINSIC
Blast:LPD_N 1282 1344 1e-21 BLAST
low complexity region 1665 1677 N/A INTRINSIC
internal_repeat_1 1915 2071 6.6e-9 PROSPERO
SCOP:d1gw5a_ 2138 2610 9e-5 SMART
internal_repeat_1 3006 3183 6.6e-9 PROSPERO
low complexity region 3594 3613 N/A INTRINSIC
low complexity region 3961 3969 N/A INTRINSIC
Pfam:ApoB100_C 4434 4490 1.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171271
SMART Domains Protein: ENSMUSP00000127147
Gene: ENSMUSG00000020609

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Vitellogenin_N 45 324 6.7e-53 PFAM
Meta Mutation Damage Score 0.1956 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 94% (95/101)
MGI Phenotype FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,290,770 V152E probably damaging Het
Abca5 T G 11: 110,276,505 E1495A probably damaging Het
Abcc12 G A 8: 86,534,998 S668F probably benign Het
Adgrl4 A T 3: 151,517,610 T608S probably benign Het
Angel2 G A 1: 190,940,990 D255N probably benign Het
Arfgef2 A T 2: 166,873,683 R1349S probably damaging Het
Atp2b2 C T 6: 113,793,695 V418I probably damaging Het
Birc6 C A 17: 74,623,746 probably benign Het
Capn13 T A 17: 73,351,524 Y183F probably damaging Het
Cngb1 A G 8: 95,260,638 S352P probably damaging Het
Col6a3 A G 1: 90,813,551 S720P probably damaging Het
Cpa4 C T 6: 30,579,658 R155W probably damaging Het
Dapk1 A G 13: 60,761,100 I1176V probably benign Het
Dnah17 T C 11: 118,058,306 E2959G probably benign Het
Dnah7b T A 1: 46,213,360 I1734N possibly damaging Het
Dnajb7 A G 15: 81,407,354 Y261H probably benign Het
Dock2 T C 11: 34,688,565 probably benign Het
Dusp27 A C 1: 166,099,701 S781A probably benign Het
Dyrk3 A T 1: 131,129,839 V199E probably damaging Het
F2r G T 13: 95,604,486 C180* probably null Het
F5 A G 1: 164,184,914 S466G probably benign Het
Fbn2 A T 18: 58,102,373 C677* probably null Het
Fbxo41 A G 6: 85,477,908 S673P probably damaging Het
Fhad1 G T 4: 141,940,095 H639N probably benign Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Foxa2 A G 2: 148,043,561 S270P probably damaging Het
Fxyd7 C T 7: 31,047,368 probably null Het
Gm5225 A G 17: 24,024,058 D67G probably benign Het
Grik3 G A 4: 125,670,556 E444K probably benign Het
Gsdma2 A G 11: 98,649,183 K44E probably damaging Het
Haus1 T A 18: 77,762,070 K130* probably null Het
Heg1 A G 16: 33,735,658 probably benign Het
Hormad2 A G 11: 4,412,206 probably benign Het
Hsd17b3 G A 13: 64,058,589 R300C possibly damaging Het
Irf5 T C 6: 29,536,109 F374S probably damaging Het
Itch A G 2: 155,217,983 probably benign Het
Jade2 A T 11: 51,831,309 L139Q probably damaging Het
Kif5c G A 2: 49,752,239 probably benign Het
Lama1 T C 17: 67,776,923 Y1387H probably benign Het
Larp4b A G 13: 9,170,688 R658G probably damaging Het
Mcph1 C T 8: 18,788,248 L729F probably benign Het
Me1 A T 9: 86,654,667 N118K probably benign Het
Med13 A G 11: 86,319,897 L473S probably damaging Het
Mgam T A 6: 40,658,987 Y359N probably damaging Het
Morc2b A G 17: 33,137,041 S586P probably damaging Het
Mthfr A G 4: 148,051,523 D310G probably benign Het
Mtmr7 A T 8: 40,581,405 probably benign Het
Mtus1 A G 8: 40,998,477 probably benign Het
Mus81 G T 19: 5,486,524 A138D probably damaging Het
Myom2 A T 8: 15,117,633 I1073F probably damaging Het
Nhsl1 A T 10: 18,525,242 K739* probably null Het
Nlrp4d T A 7: 10,374,891 K762N probably benign Het
Nrap T C 19: 56,355,546 Y724C probably damaging Het
Ogn A T 13: 49,621,038 Y219F possibly damaging Het
Olfr805 T A 10: 129,722,977 D189V probably damaging Het
Olfr923 T C 9: 38,828,564 L291P probably damaging Het
Olfr948 A T 9: 39,318,864 I250N probably damaging Het
Padi2 T C 4: 140,926,239 V180A probably benign Het
Papss2 C T 19: 32,638,368 R167* probably null Het
Pcbp2 T C 15: 102,474,235 probably benign Het
Per1 T A 11: 69,101,880 probably benign Het
Pik3ca T C 3: 32,459,945 I860T probably damaging Het
Pkdrej G A 15: 85,817,545 Q1397* probably null Het
Plce1 T C 19: 38,721,821 V1133A probably benign Het
Pnmal1 T G 7: 16,960,700 V160G probably damaging Het
Prss12 T C 3: 123,482,774 C351R probably damaging Het
Qprt A T 7: 127,109,097 L54Q probably damaging Het
Raf1 C T 6: 115,626,383 S165N probably damaging Het
Rere A G 4: 150,616,976 N1271S probably benign Het
Rnasel T A 1: 153,754,512 L258H probably damaging Het
Ryr2 T C 13: 11,709,921 D2502G probably damaging Het
Ryr3 G A 2: 112,803,165 S2081L probably damaging Het
Sc5d G T 9: 42,259,859 Y11* probably null Het
Slc25a29 A C 12: 108,827,091 L187R possibly damaging Het
Slc2a7 G A 4: 150,168,264 V454M probably benign Het
Slco1b2 A T 6: 141,669,388 T340S probably benign Het
Smarcc1 A G 9: 110,147,104 N153S possibly damaging Het
Snx1 C A 9: 66,088,539 E516* probably null Het
Sptlc2 T C 12: 87,356,680 D115G probably benign Het
Stard9 A G 2: 120,634,255 N67S probably damaging Het
Swap70 G A 7: 110,273,282 R368H probably benign Het
Tcaf3 T C 6: 42,591,350 K691E probably benign Het
Tmco4 T C 4: 139,053,920 F465S probably damaging Het
Tmem245 A G 4: 56,926,213 S290P probably benign Het
Top2a T C 11: 99,003,590 T972A probably benign Het
Tpr T A 1: 150,410,147 S527R probably damaging Het
Traf2 T C 2: 25,519,609 D443G probably damaging Het
Trim40 A T 17: 36,883,147 probably null Het
Trim42 A T 9: 97,363,403 I448N possibly damaging Het
Ttll9 G A 2: 152,983,134 V78M probably damaging Het
Vav1 C T 17: 57,296,039 L88F probably damaging Het
Vps13b A G 15: 35,423,155 D207G probably damaging Het
Wdsub1 A G 2: 59,876,665 probably null Het
Zfp799 A G 17: 32,821,035 W85R possibly damaging Het
Zfp839 A T 12: 110,858,769 probably benign Het
Other mutations in Apob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Apob APN 12 7993065 splice site probably benign
IGL00421:Apob APN 12 8010197 missense probably damaging 0.99
IGL00658:Apob APN 12 8009471 missense probably benign 0.08
IGL00768:Apob APN 12 8002107 missense probably damaging 1.00
IGL00833:Apob APN 12 8010101 missense probably benign 0.14
IGL00926:Apob APN 12 8015421 missense probably benign 0.01
IGL01065:Apob APN 12 8003299 missense probably damaging 0.99
IGL01313:Apob APN 12 8000898 missense probably damaging 1.00
IGL01419:Apob APN 12 8002251 missense probably damaging 0.99
IGL01461:Apob APN 12 8001884 missense probably benign 0.13
IGL02002:Apob APN 12 7994822 missense probably benign 0.03
IGL02031:Apob APN 12 8015222 missense probably benign
IGL02102:Apob APN 12 7989407 missense possibly damaging 0.94
IGL02115:Apob APN 12 7992923 missense probably benign 0.06
IGL02513:Apob APN 12 7992979 missense probably benign 0.01
IGL02967:Apob APN 12 8015366 nonsense probably null
IGL03005:Apob APN 12 7993059 splice site probably benign
IGL03011:Apob APN 12 7997883 missense probably damaging 1.00
IGL03116:Apob APN 12 8016350 missense probably damaging 0.98
IGL03215:Apob APN 12 8013818 missense possibly damaging 0.92
IGL03227:Apob APN 12 8016089 missense probably benign 0.04
essence UTSW 12 8007769 nonsense probably null
Ethos UTSW 12 7990394 missense probably null 1.00
IGL02835:Apob UTSW 12 8015097 missense possibly damaging 0.86
IGL02837:Apob UTSW 12 8005102 missense probably damaging 1.00
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0180:Apob UTSW 12 8008285 nonsense probably null
R0288:Apob UTSW 12 7990779 nonsense probably null
R0295:Apob UTSW 12 8002181 nonsense probably null
R0305:Apob UTSW 12 8012210 missense probably damaging 1.00
R0312:Apob UTSW 12 8009034 missense probably benign
R0324:Apob UTSW 12 8010521 missense probably benign 0.41
R0326:Apob UTSW 12 7990307 missense probably damaging 1.00
R0363:Apob UTSW 12 8010136 missense probably damaging 1.00
R0390:Apob UTSW 12 7988678 missense probably damaging 0.99
R0462:Apob UTSW 12 8000896 missense probably damaging 1.00
R0471:Apob UTSW 12 7990406 missense probably damaging 1.00
R0532:Apob UTSW 12 8016188 missense possibly damaging 0.48
R0548:Apob UTSW 12 8006282 missense probably damaging 1.00
R0560:Apob UTSW 12 8005101 missense probably damaging 1.00
R0595:Apob UTSW 12 8008369 missense probably benign 0.01
R0600:Apob UTSW 12 8006440 missense probably damaging 1.00
R0626:Apob UTSW 12 8016193 missense probably benign 0.45
R0685:Apob UTSW 12 8010742 missense probably benign
R0765:Apob UTSW 12 8016518 missense probably benign
R0790:Apob UTSW 12 8010245 missense probably damaging 1.00
R0918:Apob UTSW 12 7983941 missense probably benign 0.10
R0962:Apob UTSW 12 7989191 missense probably damaging 0.98
R1055:Apob UTSW 12 7994963 missense probably damaging 1.00
R1077:Apob UTSW 12 8006017 missense probably benign
R1143:Apob UTSW 12 8012354 missense probably benign 0.26
R1163:Apob UTSW 12 8011654 missense probably damaging 1.00
R1266:Apob UTSW 12 8006093 missense probably benign 0.37
R1434:Apob UTSW 12 8009715 missense probably damaging 1.00
R1442:Apob UTSW 12 7986165 missense probably benign 0.31
R1445:Apob UTSW 12 8016084 missense possibly damaging 0.48
R1459:Apob UTSW 12 8006047 missense probably benign
R1459:Apob UTSW 12 8011937 missense possibly damaging 0.92
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1508:Apob UTSW 12 8011481 missense possibly damaging 0.92
R1518:Apob UTSW 12 7989207 missense probably benign 0.01
R1531:Apob UTSW 12 7997880 missense possibly damaging 0.65
R1547:Apob UTSW 12 8003368 missense probably benign 0.08
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1682:Apob UTSW 12 8012365 missense probably benign 0.00
R1709:Apob UTSW 12 8009306 missense probably damaging 0.98
R1718:Apob UTSW 12 8016087 missense probably benign 0.02
R1752:Apob UTSW 12 7988766 missense probably benign 0.01
R1781:Apob UTSW 12 8009603 missense possibly damaging 0.96
R1818:Apob UTSW 12 8006834 missense probably damaging 0.98
R1818:Apob UTSW 12 8013064 missense possibly damaging 0.93
R1842:Apob UTSW 12 8011559 missense probably damaging 1.00
R1843:Apob UTSW 12 8007602 missense possibly damaging 0.65
R1853:Apob UTSW 12 8010928 nonsense probably null
R1990:Apob UTSW 12 8001039 missense probably damaging 1.00
R2016:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2017:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2023:Apob UTSW 12 8011090 missense probably benign 0.01
R2037:Apob UTSW 12 8007488 missense probably benign 0.37
R2054:Apob UTSW 12 8013134 missense probably damaging 1.00
R2057:Apob UTSW 12 8002164 nonsense probably null
R2085:Apob UTSW 12 8012240 missense probably damaging 1.00
R2159:Apob UTSW 12 8010081 missense probably benign 0.12
R2209:Apob UTSW 12 8007752 missense probably benign 0.28
R2249:Apob UTSW 12 8007499 missense probably damaging 1.00
R2254:Apob UTSW 12 8011256 missense possibly damaging 0.92
R2265:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2266:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2267:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2268:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2296:Apob UTSW 12 7994879 missense probably damaging 0.97
R2897:Apob UTSW 12 8010356 missense probably damaging 1.00
R3431:Apob UTSW 12 8010778 missense probably damaging 1.00
R3723:Apob UTSW 12 8006327 missense probably damaging 1.00
R3723:Apob UTSW 12 8011763 missense possibly damaging 0.46
R3899:Apob UTSW 12 8015849 missense possibly damaging 0.87
R4020:Apob UTSW 12 7994914 nonsense probably null
R4050:Apob UTSW 12 8015390 missense probably benign 0.02
R4351:Apob UTSW 12 7993054 missense probably benign 0.03
R4365:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4366:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4456:Apob UTSW 12 8015445 missense probably damaging 1.00
R4458:Apob UTSW 12 8015445 missense probably damaging 1.00
R4600:Apob UTSW 12 8008568 missense probably damaging 1.00
R4611:Apob UTSW 12 8011331 missense probably damaging 1.00
R4646:Apob UTSW 12 8012759 missense probably benign 0.21
R4678:Apob UTSW 12 7995585 missense probably damaging 1.00
R4685:Apob UTSW 12 8006456 missense probably benign 0.00
R4707:Apob UTSW 12 8006205 missense probably damaging 0.96
R4726:Apob UTSW 12 7990267 missense probably damaging 0.98
R4792:Apob UTSW 12 8008051 missense probably benign 0.26
R4822:Apob UTSW 12 8015741 missense probably benign 0.04
R4834:Apob UTSW 12 8014101 missense possibly damaging 0.49
R4835:Apob UTSW 12 8015391 missense possibly damaging 0.56
R4887:Apob UTSW 12 8013099 missense probably damaging 1.00
R4910:Apob UTSW 12 8007848 missense probably damaging 1.00
R5072:Apob UTSW 12 8008714 missense probably benign 0.00
R5073:Apob UTSW 12 8005219 critical splice donor site probably null
R5074:Apob UTSW 12 8005219 critical splice donor site probably null
R5101:Apob UTSW 12 8011934 missense probably benign 0.09
R5123:Apob UTSW 12 8007630 unclassified probably null
R5133:Apob UTSW 12 8008898 missense probably damaging 0.99
R5135:Apob UTSW 12 8010086 missense probably damaging 1.00
R5137:Apob UTSW 12 8011384 missense possibly damaging 0.63
R5160:Apob UTSW 12 8012126 missense possibly damaging 0.90
R5173:Apob UTSW 12 8008238 missense probably benign 0.00
R5202:Apob UTSW 12 8013737 missense probably damaging 0.98
R5229:Apob UTSW 12 7977806 missense probably benign
R5292:Apob UTSW 12 8005912 missense probably benign 0.01
R5378:Apob UTSW 12 8011865 missense probably damaging 0.99
R5494:Apob UTSW 12 8011762 missense probably damaging 0.99
R5517:Apob UTSW 12 7990906 missense probably damaging 1.00
R5576:Apob UTSW 12 7998662 missense probably damaging 1.00
R5582:Apob UTSW 12 8010788 missense probably damaging 1.00
R5629:Apob UTSW 12 8007847 missense probably damaging 1.00
R5678:Apob UTSW 12 7991494 missense possibly damaging 0.92
R5732:Apob UTSW 12 8010353 missense probably benign 0.15
R5734:Apob UTSW 12 7988781 missense probably damaging 1.00
R5742:Apob UTSW 12 8007191 missense probably damaging 1.00
R5751:Apob UTSW 12 8012619 nonsense probably null
R5776:Apob UTSW 12 8006149 missense possibly damaging 0.57
R5778:Apob UTSW 12 8015074 missense probably benign 0.45
R5783:Apob UTSW 12 8001022 missense probably damaging 1.00
R5786:Apob UTSW 12 8015304 missense possibly damaging 0.48
R5837:Apob UTSW 12 8003277 missense probably benign 0.04
R5857:Apob UTSW 12 8015397 missense probably benign 0.00
R6029:Apob UTSW 12 8016243 missense probably damaging 0.99
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6086:Apob UTSW 12 8015164 missense probably benign
R6110:Apob UTSW 12 8011883 missense probably damaging 1.00
R6131:Apob UTSW 12 8015874 missense probably benign 0.17
R6157:Apob UTSW 12 8006077 missense probably benign
R6179:Apob UTSW 12 8005060 nonsense probably null
R6247:Apob UTSW 12 8001801 missense probably damaging 1.00
R6279:Apob UTSW 12 8007769 nonsense probably null
R6300:Apob UTSW 12 8007769 nonsense probably null
R6320:Apob UTSW 12 7989194 missense probably benign 0.27
R6339:Apob UTSW 12 8016188 missense probably damaging 0.99
R6353:Apob UTSW 12 8009421 missense probably damaging 1.00
R6395:Apob UTSW 12 8008507 missense probably benign 0.45
R6441:Apob UTSW 12 7987796 missense probably damaging 1.00
R6492:Apob UTSW 12 8008261 missense probably damaging 0.99
R6495:Apob UTSW 12 7990394 missense probably null 1.00
R6502:Apob UTSW 12 8001814 missense probably damaging 0.99
R6520:Apob UTSW 12 7983124 missense probably damaging 1.00
R6644:Apob UTSW 12 8009077 missense probably damaging 0.97
R6704:Apob UTSW 12 8010379 missense probably damaging 0.98
R6750:Apob UTSW 12 7997853 missense probably damaging 1.00
R6759:Apob UTSW 12 8011049 missense probably benign 0.06
R6812:Apob UTSW 12 7983062 missense probably damaging 0.98
R6865:Apob UTSW 12 8008847 missense probably benign 0.05
R6873:Apob UTSW 12 8015995 missense probably benign 0.00
R7013:Apob UTSW 12 8010080 nonsense probably null
R7067:Apob UTSW 12 8009423 missense probably damaging 1.00
R7084:Apob UTSW 12 8009591 missense probably benign
R7113:Apob UTSW 12 7995539 missense probably damaging 1.00
R7175:Apob UTSW 12 8007034 missense probably benign 0.33
R7196:Apob UTSW 12 7983893 missense possibly damaging 0.90
R7199:Apob UTSW 12 8005072 missense probably damaging 1.00
R7205:Apob UTSW 12 8005087 missense probably damaging 0.98
R7251:Apob UTSW 12 8007037 missense probably damaging 0.98
X0027:Apob UTSW 12 8007975 missense probably benign
Z1088:Apob UTSW 12 8005074 missense possibly damaging 0.91
Z1088:Apob UTSW 12 8005945 nonsense probably null
Z1088:Apob UTSW 12 8012936 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCTGATGGCTCTGATCCCAAATCC -3'
(R):5'- ACGTGAAATACGGCGAGAATACCC -3'

Sequencing Primer
(F):5'- CATCTCTTGTCCTGAGAGAAAAGG -3'
(R):5'- TACCCTCAGAATCAAGAAGGTGTG -3'
Posted On2013-04-11