Incidental Mutation 'R1853:Olfr361'
ID208296
Institutional Source Beutler Lab
Gene Symbol Olfr361
Ensembl Gene ENSMUSG00000075378
Gene Nameolfactory receptor 361
SynonymsGA_x6K02T2NLDC-33777519-33776551, MOR159-3
MMRRC Submission 039877-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1853 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37083736-37089290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37085220 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 176 (F176Y)
Ref Sequence ENSEMBL: ENSMUSP00000149770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100145] [ENSMUST00000214969] [ENSMUST00000216663]
Predicted Effect probably damaging
Transcript: ENSMUST00000100145
AA Change: F176Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097723
Gene: ENSMUSG00000075378
AA Change: F176Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-44 PFAM
Pfam:7tm_1 41 289 2.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126779
Predicted Effect probably damaging
Transcript: ENSMUST00000214969
AA Change: F176Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216663
AA Change: F176Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,875,559 V67A probably damaging Het
9530053A07Rik C T 7: 28,155,546 Q1866* probably null Het
Acadvl T C 11: 70,010,870 K554E probably damaging Het
Acap2 C T 16: 31,117,304 E322K probably damaging Het
Adam32 T C 8: 24,898,626 Y354C probably benign Het
Agl A T 3: 116,779,322 Y789* probably null Het
Aida A G 1: 183,306,445 T68A probably benign Het
Aldh3b3 T A 19: 3,965,822 L264Q probably damaging Het
Anks6 T C 4: 47,049,387 T173A probably benign Het
Ankzf1 A G 1: 75,198,128 probably null Het
Apob A T 12: 8,010,928 K3137* probably null Het
Arhgef16 C T 4: 154,291,106 V144I probably benign Het
Arhgef2 A T 3: 88,632,915 T107S possibly damaging Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
Atp6ap1l T C 13: 90,883,588 E325G probably damaging Het
BC035947 T C 1: 78,499,016 N293S possibly damaging Het
Bhmt C T 13: 93,625,335 V147M probably damaging Het
Ccdc112 A T 18: 46,285,700 H447Q probably benign Het
Cd274 T A 19: 29,380,482 N191K probably damaging Het
Ckmt1 C T 2: 121,360,650 T181I probably damaging Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col28a1 T G 6: 8,014,574 I944L probably benign Het
Cttnbp2 T C 6: 18,408,602 T1007A probably benign Het
Cux2 G T 5: 121,869,121 P826T possibly damaging Het
Dap3 A T 3: 88,930,926 V86E probably damaging Het
Ddah1 A G 3: 145,891,549 I180M probably benign Het
Ddt T C 10: 75,773,304 E7G possibly damaging Het
Dhx57 A T 17: 80,274,879 Y432* probably null Het
Dpp9 T C 17: 56,202,885 I314V probably benign Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Ercc6 T A 14: 32,576,816 I1387N possibly damaging Het
Fancg T C 4: 43,009,727 E57G probably benign Het
Fkbp5 A T 17: 28,429,307 C103S possibly damaging Het
Gm14403 C A 2: 177,509,139 H293N probably damaging Het
Gm4353 G A 7: 116,083,569 P259L probably benign Het
Gm4787 T A 12: 81,378,334 H350L probably damaging Het
Hibch T C 1: 52,901,335 probably null Het
Impg2 T C 16: 56,260,277 S815P probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Kcnd3 A T 3: 105,459,752 T313S probably damaging Het
Kctd14 A T 7: 97,453,424 S38C possibly damaging Het
Kdm3b G T 18: 34,833,393 R1660L probably damaging Het
Kdr C T 5: 75,952,905 G768S possibly damaging Het
Klhl2 G A 8: 64,823,006 H82Y probably benign Het
Lama3 A T 18: 12,513,705 T1759S possibly damaging Het
Lamb1 T G 12: 31,318,272 C1134G probably damaging Het
Macf1 T C 4: 123,512,720 probably null Het
Mlph C T 1: 90,945,667 Q567* probably null Het
Mocos A C 18: 24,695,969 E777A probably damaging Het
Neil1 T A 9: 57,144,715 Q214L probably damaging Het
Nes A G 3: 87,975,807 T458A possibly damaging Het
Nlgn1 A T 3: 26,133,522 N71K possibly damaging Het
Nr4a1 T C 15: 101,271,764 I305T probably benign Het
Nupl1 T C 14: 60,244,547 T123A possibly damaging Het
Oas1c A T 5: 120,807,995 V146E probably damaging Het
Oit3 C T 10: 59,441,622 probably null Het
Olfr726 A G 14: 50,084,120 L187P probably damaging Het
Osbp T C 19: 11,973,891 S267P possibly damaging Het
Pclo T A 5: 14,676,684 probably benign Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Pdia3 T C 2: 121,431,663 I205T probably benign Het
Pdia4 A T 6: 47,813,227 D26E unknown Het
Pds5a A G 5: 65,624,029 V1036A possibly damaging Het
Pitx3 C T 19: 46,137,473 G4R probably benign Het
Pnn T A 12: 59,071,613 N327K probably damaging Het
Pole T G 5: 110,306,853 I984R possibly damaging Het
Ppil2 A C 16: 17,107,223 D28E probably benign Het
Psme2 T A 14: 55,588,479 I124F probably damaging Het
Pstpip2 T A 18: 77,871,799 L198Q probably damaging Het
Rnf165 T A 18: 77,462,975 S279C possibly damaging Het
Siglece A G 7: 43,659,936 F66S probably benign Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Snd1 T A 6: 28,545,564 I373N probably damaging Het
Srrm2 A G 17: 23,820,525 T2144A probably damaging Het
Sst A G 16: 23,890,653 L31P probably damaging Het
Stab1 C T 14: 31,140,463 V2305M probably damaging Het
Stard9 T C 2: 120,688,751 I545T probably damaging Het
Tcaim T C 9: 122,826,206 W248R probably damaging Het
Tepsin A C 11: 120,098,636 F13C probably damaging Het
Terf1 T A 1: 15,818,938 L197* probably null Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Tmem63b G A 17: 45,661,297 H745Y possibly damaging Het
Trim40 A G 17: 36,889,078 L36P probably damaging Het
Trim72 A G 7: 128,009,082 I251V probably benign Het
Trio T C 15: 27,756,536 Y914C probably damaging Het
Vmn2r113 G A 17: 22,945,527 V135I probably benign Het
Vmn2r117 T A 17: 23,477,455 H326L probably damaging Het
Vmn2r28 A T 7: 5,481,247 C651* probably null Het
Xpnpep1 T C 19: 53,006,210 E329G probably benign Het
Xpo4 G A 14: 57,585,907 T1042M possibly damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,305,542 probably null Het
Zfp51 A T 17: 21,464,323 H400L probably damaging Het
Zfp518b A T 5: 38,673,407 F418L probably benign Het
Zfp54 T A 17: 21,434,142 Y299* probably null Het
Zfp672 T C 11: 58,316,964 H177R probably benign Het
Zfp692 C A 11: 58,309,979 P229T possibly damaging Het
Zswim4 A T 8: 84,224,200 C533S probably damaging Het
Other mutations in Olfr361
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Olfr361 APN 2 37085395 missense possibly damaging 0.94
IGL02210:Olfr361 APN 2 37085619 missense possibly damaging 0.54
IGL03180:Olfr361 APN 2 37085710 missense possibly damaging 0.58
R0571:Olfr361 UTSW 2 37085334 missense probably benign 0.00
R1715:Olfr361 UTSW 2 37085176 missense probably damaging 1.00
R2403:Olfr361 UTSW 2 37084974 missense probably benign 0.34
R3009:Olfr361 UTSW 2 37085077 missense probably benign 0.00
R3713:Olfr361 UTSW 2 37085505 missense possibly damaging 0.73
R4355:Olfr361 UTSW 2 37084930 missense probably benign 0.44
R4476:Olfr361 UTSW 2 37085061 missense probably damaging 1.00
R5191:Olfr361 UTSW 2 37084978 missense probably benign 0.00
R5387:Olfr361 UTSW 2 37085719 missense possibly damaging 0.58
R5529:Olfr361 UTSW 2 37084909 missense possibly damaging 0.67
R5891:Olfr361 UTSW 2 37084978 missense probably benign 0.00
R7078:Olfr361 UTSW 2 37085596 missense not run
Predicted Primers PCR Primer
(F):5'- AGTGGACAGAGCTTTCTGCAG -3'
(R):5'- AGTGGGCAGTATGGAAGTTCAC -3'

Sequencing Primer
(F):5'- CAGGGCAGCAACTGAGTGC -3'
(R):5'- CAGTATGGAAGTTCACTTGCTTG -3'
Posted On2014-06-23