Incidental Mutation 'R1853:Pole'
ID208318
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Namepolymerase (DNA directed), epsilon
Synonymspol-epsilon
MMRRC Submission 039877-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1853 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location110286306-110337474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 110306853 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 984 (I984R)
Ref Sequence ENSEMBL: ENSMUSP00000007296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007296
AA Change: I984R

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: I984R

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131887
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,875,559 V67A probably damaging Het
9530053A07Rik C T 7: 28,155,546 Q1866* probably null Het
Acadvl T C 11: 70,010,870 K554E probably damaging Het
Acap2 C T 16: 31,117,304 E322K probably damaging Het
Adam32 T C 8: 24,898,626 Y354C probably benign Het
Agl A T 3: 116,779,322 Y789* probably null Het
Aida A G 1: 183,306,445 T68A probably benign Het
Aldh3b3 T A 19: 3,965,822 L264Q probably damaging Het
Anks6 T C 4: 47,049,387 T173A probably benign Het
Ankzf1 A G 1: 75,198,128 probably null Het
Apob A T 12: 8,010,928 K3137* probably null Het
Arhgef16 C T 4: 154,291,106 V144I probably benign Het
Arhgef2 A T 3: 88,632,915 T107S possibly damaging Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
Atp6ap1l T C 13: 90,883,588 E325G probably damaging Het
BC035947 T C 1: 78,499,016 N293S possibly damaging Het
Bhmt C T 13: 93,625,335 V147M probably damaging Het
Ccdc112 A T 18: 46,285,700 H447Q probably benign Het
Cd274 T A 19: 29,380,482 N191K probably damaging Het
Ckmt1 C T 2: 121,360,650 T181I probably damaging Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col28a1 T G 6: 8,014,574 I944L probably benign Het
Cttnbp2 T C 6: 18,408,602 T1007A probably benign Het
Cux2 G T 5: 121,869,121 P826T possibly damaging Het
Dap3 A T 3: 88,930,926 V86E probably damaging Het
Ddah1 A G 3: 145,891,549 I180M probably benign Het
Ddt T C 10: 75,773,304 E7G possibly damaging Het
Dhx57 A T 17: 80,274,879 Y432* probably null Het
Dpp9 T C 17: 56,202,885 I314V probably benign Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Ercc6 T A 14: 32,576,816 I1387N possibly damaging Het
Fancg T C 4: 43,009,727 E57G probably benign Het
Fkbp5 A T 17: 28,429,307 C103S possibly damaging Het
Gm14403 C A 2: 177,509,139 H293N probably damaging Het
Gm4353 G A 7: 116,083,569 P259L probably benign Het
Gm4787 T A 12: 81,378,334 H350L probably damaging Het
Hibch T C 1: 52,901,335 probably null Het
Impg2 T C 16: 56,260,277 S815P probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Kcnd3 A T 3: 105,459,752 T313S probably damaging Het
Kctd14 A T 7: 97,453,424 S38C possibly damaging Het
Kdm3b G T 18: 34,833,393 R1660L probably damaging Het
Kdr C T 5: 75,952,905 G768S possibly damaging Het
Klhl2 G A 8: 64,823,006 H82Y probably benign Het
Lama3 A T 18: 12,513,705 T1759S possibly damaging Het
Lamb1 T G 12: 31,318,272 C1134G probably damaging Het
Macf1 T C 4: 123,512,720 probably null Het
Mlph C T 1: 90,945,667 Q567* probably null Het
Mocos A C 18: 24,695,969 E777A probably damaging Het
Neil1 T A 9: 57,144,715 Q214L probably damaging Het
Nes A G 3: 87,975,807 T458A possibly damaging Het
Nlgn1 A T 3: 26,133,522 N71K possibly damaging Het
Nr4a1 T C 15: 101,271,764 I305T probably benign Het
Nupl1 T C 14: 60,244,547 T123A possibly damaging Het
Oas1c A T 5: 120,807,995 V146E probably damaging Het
Oit3 C T 10: 59,441,622 probably null Het
Olfr361 A T 2: 37,085,220 F176Y probably damaging Het
Olfr726 A G 14: 50,084,120 L187P probably damaging Het
Osbp T C 19: 11,973,891 S267P possibly damaging Het
Pclo T A 5: 14,676,684 probably benign Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Pdia3 T C 2: 121,431,663 I205T probably benign Het
Pdia4 A T 6: 47,813,227 D26E unknown Het
Pds5a A G 5: 65,624,029 V1036A possibly damaging Het
Pitx3 C T 19: 46,137,473 G4R probably benign Het
Pnn T A 12: 59,071,613 N327K probably damaging Het
Ppil2 A C 16: 17,107,223 D28E probably benign Het
Psme2 T A 14: 55,588,479 I124F probably damaging Het
Pstpip2 T A 18: 77,871,799 L198Q probably damaging Het
Rnf165 T A 18: 77,462,975 S279C possibly damaging Het
Siglece A G 7: 43,659,936 F66S probably benign Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Snd1 T A 6: 28,545,564 I373N probably damaging Het
Srrm2 A G 17: 23,820,525 T2144A probably damaging Het
Sst A G 16: 23,890,653 L31P probably damaging Het
Stab1 C T 14: 31,140,463 V2305M probably damaging Het
Stard9 T C 2: 120,688,751 I545T probably damaging Het
Tcaim T C 9: 122,826,206 W248R probably damaging Het
Tepsin A C 11: 120,098,636 F13C probably damaging Het
Terf1 T A 1: 15,818,938 L197* probably null Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Tmem63b G A 17: 45,661,297 H745Y possibly damaging Het
Trim40 A G 17: 36,889,078 L36P probably damaging Het
Trim72 A G 7: 128,009,082 I251V probably benign Het
Trio T C 15: 27,756,536 Y914C probably damaging Het
Vmn2r113 G A 17: 22,945,527 V135I probably benign Het
Vmn2r117 T A 17: 23,477,455 H326L probably damaging Het
Vmn2r28 A T 7: 5,481,247 C651* probably null Het
Xpnpep1 T C 19: 53,006,210 E329G probably benign Het
Xpo4 G A 14: 57,585,907 T1042M possibly damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,305,542 probably null Het
Zfp51 A T 17: 21,464,323 H400L probably damaging Het
Zfp518b A T 5: 38,673,407 F418L probably benign Het
Zfp54 T A 17: 21,434,142 Y299* probably null Het
Zfp672 T C 11: 58,316,964 H177R probably benign Het
Zfp692 C A 11: 58,309,979 P229T possibly damaging Het
Zswim4 A T 8: 84,224,200 C533S probably damaging Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1626:Pole UTSW 5 110293369 missense probably benign 0.25
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1874:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2341:Pole UTSW 5 110330963 missense possibly damaging 0.67
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3053:Pole UTSW 5 110289795 missense probably damaging 1.00
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5184:Pole UTSW 5 110294934 missense possibly damaging 0.91
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CCTAAGGGACGAGCATTGAG -3'
(R):5'- GTCCAATTCCTTGACAGATGC -3'

Sequencing Primer
(F):5'- TTGCTGCCTCAGAGATGAC -3'
(R):5'- TGACAGATGCTCACTCCTGAG -3'
Posted On2014-06-23