Incidental Mutation 'R1853:3110062M04Rik'
ID208325
Institutional Source Beutler Lab
Gene Symbol 3110062M04Rik
Ensembl Gene ENSMUSG00000046806
Gene NameRIKEN cDNA 3110062M04 gene
Synonyms
MMRRC Submission 039877-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1853 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location34871771-34878060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34875559 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 67 (V67A)
Ref Sequence ENSEMBL: ENSMUSP00000113335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055097] [ENSMUST00000074949] [ENSMUST00000081214] [ENSMUST00000115006] [ENSMUST00000115007] [ENSMUST00000118559] [ENSMUST00000146968] [ENSMUST00000202010] [ENSMUST00000202999]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055097
AA Change: V67A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053349
Gene: ENSMUSG00000046806
AA Change: V67A

DomainStartEndE-ValueType
Pfam:MRI 55 157 2.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074949
SMART Domains Protein: ENSMUSP00000074482
Gene: ENSMUSG00000057137

DomainStartEndE-ValueType
Pfam:TM140 6 185 3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081214
SMART Domains Protein: ENSMUSP00000079974
Gene: ENSMUSG00000058486

DomainStartEndE-ValueType
Blast:LisH 5 36 3e-6 BLAST
coiled coil region 179 228 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
WD40 393 437 6.34e-2 SMART
WD40 442 480 3.42e1 SMART
Blast:WD40 483 525 1e-19 BLAST
WD40 552 591 1.88e-4 SMART
WD40 594 633 3.96e-3 SMART
WD40 701 742 8.59e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115006
AA Change: V67A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110658
Gene: ENSMUSG00000046806
AA Change: V67A

DomainStartEndE-ValueType
Pfam:MRI 55 82 3.1e-13 PFAM
Pfam:MRI 97 184 1.2e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115007
AA Change: V67A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110659
Gene: ENSMUSG00000046806
AA Change: V67A

DomainStartEndE-ValueType
Pfam:MRI 55 157 2.6e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118559
AA Change: V67A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113335
Gene: ENSMUSG00000046806
AA Change: V67A

DomainStartEndE-ValueType
Pfam:MRI 55 90 4.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140458
Predicted Effect probably benign
Transcript: ENSMUST00000146968
SMART Domains Protein: ENSMUSP00000138406
Gene: ENSMUSG00000058486

DomainStartEndE-ValueType
Blast:LisH 5 36 2e-6 BLAST
coiled coil region 179 228 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
WD40 393 437 6.34e-2 SMART
WD40 442 480 3.42e1 SMART
Blast:WD40 483 525 1e-19 BLAST
WD40 552 591 1.48e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202764
Predicted Effect probably benign
Transcript: ENSMUST00000202999
SMART Domains Protein: ENSMUSP00000144113
Gene: ENSMUSG00000057137

DomainStartEndE-ValueType
Pfam:TM140 6 63 4.9e-26 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,155,546 Q1866* probably null Het
Acadvl T C 11: 70,010,870 K554E probably damaging Het
Acap2 C T 16: 31,117,304 E322K probably damaging Het
Adam32 T C 8: 24,898,626 Y354C probably benign Het
Agl A T 3: 116,779,322 Y789* probably null Het
Aida A G 1: 183,306,445 T68A probably benign Het
Aldh3b3 T A 19: 3,965,822 L264Q probably damaging Het
Anks6 T C 4: 47,049,387 T173A probably benign Het
Ankzf1 A G 1: 75,198,128 probably null Het
Apob A T 12: 8,010,928 K3137* probably null Het
Arhgef16 C T 4: 154,291,106 V144I probably benign Het
Arhgef2 A T 3: 88,632,915 T107S possibly damaging Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
Atp6ap1l T C 13: 90,883,588 E325G probably damaging Het
BC035947 T C 1: 78,499,016 N293S possibly damaging Het
Bhmt C T 13: 93,625,335 V147M probably damaging Het
Ccdc112 A T 18: 46,285,700 H447Q probably benign Het
Cd274 T A 19: 29,380,482 N191K probably damaging Het
Ckmt1 C T 2: 121,360,650 T181I probably damaging Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col28a1 T G 6: 8,014,574 I944L probably benign Het
Cttnbp2 T C 6: 18,408,602 T1007A probably benign Het
Cux2 G T 5: 121,869,121 P826T possibly damaging Het
Dap3 A T 3: 88,930,926 V86E probably damaging Het
Ddah1 A G 3: 145,891,549 I180M probably benign Het
Ddt T C 10: 75,773,304 E7G possibly damaging Het
Dhx57 A T 17: 80,274,879 Y432* probably null Het
Dpp9 T C 17: 56,202,885 I314V probably benign Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Ercc6 T A 14: 32,576,816 I1387N possibly damaging Het
Fancg T C 4: 43,009,727 E57G probably benign Het
Fkbp5 A T 17: 28,429,307 C103S possibly damaging Het
Gm14403 C A 2: 177,509,139 H293N probably damaging Het
Gm4353 G A 7: 116,083,569 P259L probably benign Het
Gm4787 T A 12: 81,378,334 H350L probably damaging Het
Hibch T C 1: 52,901,335 probably null Het
Impg2 T C 16: 56,260,277 S815P probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Kcnd3 A T 3: 105,459,752 T313S probably damaging Het
Kctd14 A T 7: 97,453,424 S38C possibly damaging Het
Kdm3b G T 18: 34,833,393 R1660L probably damaging Het
Kdr C T 5: 75,952,905 G768S possibly damaging Het
Klhl2 G A 8: 64,823,006 H82Y probably benign Het
Lama3 A T 18: 12,513,705 T1759S possibly damaging Het
Lamb1 T G 12: 31,318,272 C1134G probably damaging Het
Macf1 T C 4: 123,512,720 probably null Het
Mlph C T 1: 90,945,667 Q567* probably null Het
Mocos A C 18: 24,695,969 E777A probably damaging Het
Neil1 T A 9: 57,144,715 Q214L probably damaging Het
Nes A G 3: 87,975,807 T458A possibly damaging Het
Nlgn1 A T 3: 26,133,522 N71K possibly damaging Het
Nr4a1 T C 15: 101,271,764 I305T probably benign Het
Nupl1 T C 14: 60,244,547 T123A possibly damaging Het
Oas1c A T 5: 120,807,995 V146E probably damaging Het
Oit3 C T 10: 59,441,622 probably null Het
Olfr361 A T 2: 37,085,220 F176Y probably damaging Het
Olfr726 A G 14: 50,084,120 L187P probably damaging Het
Osbp T C 19: 11,973,891 S267P possibly damaging Het
Pclo T A 5: 14,676,684 probably benign Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Pdia3 T C 2: 121,431,663 I205T probably benign Het
Pdia4 A T 6: 47,813,227 D26E unknown Het
Pds5a A G 5: 65,624,029 V1036A possibly damaging Het
Pitx3 C T 19: 46,137,473 G4R probably benign Het
Pnn T A 12: 59,071,613 N327K probably damaging Het
Pole T G 5: 110,306,853 I984R possibly damaging Het
Ppil2 A C 16: 17,107,223 D28E probably benign Het
Psme2 T A 14: 55,588,479 I124F probably damaging Het
Pstpip2 T A 18: 77,871,799 L198Q probably damaging Het
Rnf165 T A 18: 77,462,975 S279C possibly damaging Het
Siglece A G 7: 43,659,936 F66S probably benign Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Snd1 T A 6: 28,545,564 I373N probably damaging Het
Srrm2 A G 17: 23,820,525 T2144A probably damaging Het
Sst A G 16: 23,890,653 L31P probably damaging Het
Stab1 C T 14: 31,140,463 V2305M probably damaging Het
Stard9 T C 2: 120,688,751 I545T probably damaging Het
Tcaim T C 9: 122,826,206 W248R probably damaging Het
Tepsin A C 11: 120,098,636 F13C probably damaging Het
Terf1 T A 1: 15,818,938 L197* probably null Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Tmem63b G A 17: 45,661,297 H745Y possibly damaging Het
Trim40 A G 17: 36,889,078 L36P probably damaging Het
Trim72 A G 7: 128,009,082 I251V probably benign Het
Trio T C 15: 27,756,536 Y914C probably damaging Het
Vmn2r113 G A 17: 22,945,527 V135I probably benign Het
Vmn2r117 T A 17: 23,477,455 H326L probably damaging Het
Vmn2r28 A T 7: 5,481,247 C651* probably null Het
Xpnpep1 T C 19: 53,006,210 E329G probably benign Het
Xpo4 G A 14: 57,585,907 T1042M possibly damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,305,542 probably null Het
Zfp51 A T 17: 21,464,323 H400L probably damaging Het
Zfp518b A T 5: 38,673,407 F418L probably benign Het
Zfp54 T A 17: 21,434,142 Y299* probably null Het
Zfp672 T C 11: 58,316,964 H177R probably benign Het
Zfp692 C A 11: 58,309,979 P229T possibly damaging Het
Zswim4 A T 8: 84,224,200 C533S probably damaging Het
Other mutations in 3110062M04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02420:3110062M04Rik APN 6 34874469 missense probably damaging 1.00
R5879:3110062M04Rik UTSW 6 34874658 missense probably damaging 0.99
R6086:3110062M04Rik UTSW 6 34874620 missense probably damaging 0.99
R6484:3110062M04Rik UTSW 6 34874616 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGTCTCAAAGGCTCACCCC -3'
(R):5'- TGGACCACTAGGCTGAGGAAAC -3'

Sequencing Primer
(F):5'- AAGGCTCACCCCACGTG -3'
(R):5'- TGCGTCTCTGTTTCAGAG -3'
Posted On2014-06-23