Incidental Mutation 'R1853:Ppil2'
ID208368
Institutional Source Beutler Lab
Gene Symbol Ppil2
Ensembl Gene ENSMUSG00000022771
Gene Namepeptidylprolyl isomerase (cyclophilin)-like 2
Synonyms
MMRRC Submission 039877-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1853 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17086555-17111257 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 17107223 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 28 (D28E)
Ref Sequence ENSEMBL: ENSMUSP00000156086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023455] [ENSMUST00000115719] [ENSMUST00000115721] [ENSMUST00000164458] [ENSMUST00000231245] [ENSMUST00000231451] [ENSMUST00000231712] [ENSMUST00000232481]
Predicted Effect probably benign
Transcript: ENSMUST00000023455
AA Change: D28E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023455
Gene: ENSMUSG00000022771
AA Change: D28E

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115719
AA Change: D28E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111384
Gene: ENSMUSG00000022771
AA Change: D28E

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115721
AA Change: D28E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111386
Gene: ENSMUSG00000022771
AA Change: D28E

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 3.7e-53 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156521
Predicted Effect probably benign
Transcript: ENSMUST00000164458
AA Change: D28E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131422
Gene: ENSMUSG00000022771
AA Change: D28E

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231245
AA Change: D28E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231451
AA Change: D28E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231635
Predicted Effect probably benign
Transcript: ENSMUST00000231712
AA Change: D28E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232169
Predicted Effect probably benign
Transcript: ENSMUST00000232481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232510
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cyclophilin family of peptidylprolyl isomerases. The cyclophilins are a highly conserved ubiquitous family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. This protein interacts with the proteinase inhibitor eglin c and is localized in the nucleus. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,875,559 V67A probably damaging Het
9530053A07Rik C T 7: 28,155,546 Q1866* probably null Het
Acadvl T C 11: 70,010,870 K554E probably damaging Het
Acap2 C T 16: 31,117,304 E322K probably damaging Het
Adam32 T C 8: 24,898,626 Y354C probably benign Het
Agl A T 3: 116,779,322 Y789* probably null Het
Aida A G 1: 183,306,445 T68A probably benign Het
Aldh3b3 T A 19: 3,965,822 L264Q probably damaging Het
Anks6 T C 4: 47,049,387 T173A probably benign Het
Ankzf1 A G 1: 75,198,128 probably null Het
Apob A T 12: 8,010,928 K3137* probably null Het
Arhgef16 C T 4: 154,291,106 V144I probably benign Het
Arhgef2 A T 3: 88,632,915 T107S possibly damaging Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
Atp6ap1l T C 13: 90,883,588 E325G probably damaging Het
BC035947 T C 1: 78,499,016 N293S possibly damaging Het
Bhmt C T 13: 93,625,335 V147M probably damaging Het
Ccdc112 A T 18: 46,285,700 H447Q probably benign Het
Cd274 T A 19: 29,380,482 N191K probably damaging Het
Ckmt1 C T 2: 121,360,650 T181I probably damaging Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col28a1 T G 6: 8,014,574 I944L probably benign Het
Cttnbp2 T C 6: 18,408,602 T1007A probably benign Het
Cux2 G T 5: 121,869,121 P826T possibly damaging Het
Dap3 A T 3: 88,930,926 V86E probably damaging Het
Ddah1 A G 3: 145,891,549 I180M probably benign Het
Ddt T C 10: 75,773,304 E7G possibly damaging Het
Dhx57 A T 17: 80,274,879 Y432* probably null Het
Dpp9 T C 17: 56,202,885 I314V probably benign Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Ercc6 T A 14: 32,576,816 I1387N possibly damaging Het
Fancg T C 4: 43,009,727 E57G probably benign Het
Fkbp5 A T 17: 28,429,307 C103S possibly damaging Het
Gm14403 C A 2: 177,509,139 H293N probably damaging Het
Gm4353 G A 7: 116,083,569 P259L probably benign Het
Gm4787 T A 12: 81,378,334 H350L probably damaging Het
Hibch T C 1: 52,901,335 probably null Het
Impg2 T C 16: 56,260,277 S815P probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Kcnd3 A T 3: 105,459,752 T313S probably damaging Het
Kctd14 A T 7: 97,453,424 S38C possibly damaging Het
Kdm3b G T 18: 34,833,393 R1660L probably damaging Het
Kdr C T 5: 75,952,905 G768S possibly damaging Het
Klhl2 G A 8: 64,823,006 H82Y probably benign Het
Lama3 A T 18: 12,513,705 T1759S possibly damaging Het
Lamb1 T G 12: 31,318,272 C1134G probably damaging Het
Macf1 T C 4: 123,512,720 probably null Het
Mlph C T 1: 90,945,667 Q567* probably null Het
Mocos A C 18: 24,695,969 E777A probably damaging Het
Neil1 T A 9: 57,144,715 Q214L probably damaging Het
Nes A G 3: 87,975,807 T458A possibly damaging Het
Nlgn1 A T 3: 26,133,522 N71K possibly damaging Het
Nr4a1 T C 15: 101,271,764 I305T probably benign Het
Nupl1 T C 14: 60,244,547 T123A possibly damaging Het
Oas1c A T 5: 120,807,995 V146E probably damaging Het
Oit3 C T 10: 59,441,622 probably null Het
Olfr361 A T 2: 37,085,220 F176Y probably damaging Het
Olfr726 A G 14: 50,084,120 L187P probably damaging Het
Osbp T C 19: 11,973,891 S267P possibly damaging Het
Pclo T A 5: 14,676,684 probably benign Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Pdia3 T C 2: 121,431,663 I205T probably benign Het
Pdia4 A T 6: 47,813,227 D26E unknown Het
Pds5a A G 5: 65,624,029 V1036A possibly damaging Het
Pitx3 C T 19: 46,137,473 G4R probably benign Het
Pnn T A 12: 59,071,613 N327K probably damaging Het
Pole T G 5: 110,306,853 I984R possibly damaging Het
Psme2 T A 14: 55,588,479 I124F probably damaging Het
Pstpip2 T A 18: 77,871,799 L198Q probably damaging Het
Rnf165 T A 18: 77,462,975 S279C possibly damaging Het
Siglece A G 7: 43,659,936 F66S probably benign Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Snd1 T A 6: 28,545,564 I373N probably damaging Het
Srrm2 A G 17: 23,820,525 T2144A probably damaging Het
Sst A G 16: 23,890,653 L31P probably damaging Het
Stab1 C T 14: 31,140,463 V2305M probably damaging Het
Stard9 T C 2: 120,688,751 I545T probably damaging Het
Tcaim T C 9: 122,826,206 W248R probably damaging Het
Tepsin A C 11: 120,098,636 F13C probably damaging Het
Terf1 T A 1: 15,818,938 L197* probably null Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Tmem63b G A 17: 45,661,297 H745Y possibly damaging Het
Trim40 A G 17: 36,889,078 L36P probably damaging Het
Trim72 A G 7: 128,009,082 I251V probably benign Het
Trio T C 15: 27,756,536 Y914C probably damaging Het
Vmn2r113 G A 17: 22,945,527 V135I probably benign Het
Vmn2r117 T A 17: 23,477,455 H326L probably damaging Het
Vmn2r28 A T 7: 5,481,247 C651* probably null Het
Xpnpep1 T C 19: 53,006,210 E329G probably benign Het
Xpo4 G A 14: 57,585,907 T1042M possibly damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,305,542 probably null Het
Zfp51 A T 17: 21,464,323 H400L probably damaging Het
Zfp518b A T 5: 38,673,407 F418L probably benign Het
Zfp54 T A 17: 21,434,142 Y299* probably null Het
Zfp672 T C 11: 58,316,964 H177R probably benign Het
Zfp692 C A 11: 58,309,979 P229T possibly damaging Het
Zswim4 A T 8: 84,224,200 C533S probably damaging Het
Other mutations in Ppil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ppil2 APN 16 17091212 missense probably damaging 1.00
IGL02392:Ppil2 APN 16 17088838 missense probably benign
IGL02559:Ppil2 APN 16 17109651 missense possibly damaging 0.80
IGL02708:Ppil2 APN 16 17106008 missense probably benign 0.03
IGL02724:Ppil2 APN 16 17103602 missense probably benign 0.08
zagnut UTSW 16 17096041 missense possibly damaging 0.62
R0592:Ppil2 UTSW 16 17107219 missense probably benign
R0975:Ppil2 UTSW 16 17107213 missense probably benign 0.00
R1258:Ppil2 UTSW 16 17106053 missense probably damaging 1.00
R1677:Ppil2 UTSW 16 17103610 missense probably damaging 1.00
R1728:Ppil2 UTSW 16 17089419 unclassified probably benign
R1739:Ppil2 UTSW 16 17089419 unclassified probably benign
R1784:Ppil2 UTSW 16 17089419 unclassified probably benign
R3608:Ppil2 UTSW 16 17092290 nonsense probably null
R3769:Ppil2 UTSW 16 17109668 missense probably benign 0.30
R4445:Ppil2 UTSW 16 17103600 nonsense probably null
R4518:Ppil2 UTSW 16 17096041 missense possibly damaging 0.62
R5066:Ppil2 UTSW 16 17109675 missense probably benign 0.03
R5842:Ppil2 UTSW 16 17094987 missense possibly damaging 0.66
R6013:Ppil2 UTSW 16 17100265 missense probably damaging 1.00
R6415:Ppil2 UTSW 16 17103574 critical splice donor site probably null
X0010:Ppil2 UTSW 16 17095037 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TACTTGGGAGGTAGCAGCAG -3'
(R):5'- TCTTCTTTCTCGAAACAACAGC -3'

Sequencing Primer
(F):5'- CAGCAGGAGATTCAGGAGTTC -3'
(R):5'- AACTCGCTTTGTAGACCAGG -3'
Posted On2014-06-23