Incidental Mutation 'R1864:Obsl1'
ID208441
Institutional Source Beutler Lab
Gene Symbol Obsl1
Ensembl Gene ENSMUSG00000026211
Gene Nameobscurin-like 1
Synonyms
MMRRC Submission 039887-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R1864 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75479310-75506452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75493109 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 1088 (S1088F)
Ref Sequence ENSEMBL: ENSMUSP00000109197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113565] [ENSMUST00000113567]
Predicted Effect probably benign
Transcript: ENSMUST00000113565
SMART Domains Protein: ENSMUSP00000109195
Gene: ENSMUSG00000026211

DomainStartEndE-ValueType
IGc2 24 91 1.23e-12 SMART
IGc2 140 216 2.33e-13 SMART
IGc2 258 326 1.48e-6 SMART
IG 347 427 9.49e-5 SMART
IG 435 511 1.04e-1 SMART
FN3 518 601 6.6e-2 SMART
PDB:2E6Q|A 608 714 5e-57 PDB
Blast:IG_like 622 711 2e-50 BLAST
IG 723 804 3.79e-4 SMART
IG 814 893 2.58e-6 SMART
IGc2 911 977 1.12e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113567
AA Change: S1088F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109197
Gene: ENSMUSG00000026211
AA Change: S1088F

DomainStartEndE-ValueType
IGc2 24 91 1.23e-12 SMART
IGc2 140 216 2.33e-13 SMART
IGc2 258 326 1.48e-6 SMART
IG 347 427 9.49e-5 SMART
IG 435 511 1.04e-1 SMART
FN3 518 601 6.6e-2 SMART
PDB:2E6Q|A 608 714 8e-57 PDB
Blast:IG_like 622 711 3e-50 BLAST
IG 723 804 3.79e-4 SMART
IG 814 893 2.58e-6 SMART
IGc2 911 977 1.12e-6 SMART
IG 996 1075 1.27e-5 SMART
IGc2 1094 1160 4.07e-4 SMART
IGc2 1186 1252 9.49e-5 SMART
IG 1274 1353 7.41e-7 SMART
IG 1363 1444 1.15e-3 SMART
IG 1454 1533 8.33e-1 SMART
IGc2 1549 1615 8.72e-4 SMART
IG 1633 1712 1e-3 SMART
IG 1723 1802 3.82e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127507
Predicted Effect probably benign
Transcript: ENSMUST00000132252
SMART Domains Protein: ENSMUSP00000117420
Gene: ENSMUSG00000026211

DomainStartEndE-ValueType
IG_like 1 59 2.8e-1 SMART
IGc2 85 151 9.49e-5 SMART
IG 175 254 2.64e-3 SMART
IG 265 344 7.41e-7 SMART
Blast:IG 354 417 4e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150293
Predicted Effect unknown
Transcript: ENSMUST00000155084
AA Change: S893F
SMART Domains Protein: ENSMUSP00000114553
Gene: ENSMUSG00000026211
AA Change: S893F

DomainStartEndE-ValueType
SCOP:d1g1ca_ 2 32 1e-3 SMART
IGc2 64 132 1.48e-6 SMART
IG 153 233 9.49e-5 SMART
IG 241 317 1.04e-1 SMART
FN3 324 407 6.6e-2 SMART
PDB:2E6Q|A 414 520 4e-57 PDB
Blast:IG_like 428 517 2e-50 BLAST
IG 529 610 3.79e-4 SMART
IG 620 699 2.58e-6 SMART
IGc2 717 783 1.12e-6 SMART
IG 802 881 1.27e-5 SMART
IGc2 900 966 4.07e-4 SMART
IGc2 992 1058 9.49e-5 SMART
IG 1080 1159 7.41e-7 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agtpbp1 A G 13: 59,450,202 Y1198H possibly damaging Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
AI314180 T A 4: 58,849,942 H427L possibly damaging Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ankrd50 A T 3: 38,454,461 N329K probably benign Het
Ano4 C A 10: 88,971,391 G741V probably damaging Het
Anxa1 T C 19: 20,379,689 D191G probably benign Het
Apc2 C T 10: 80,313,648 T1512I probably damaging Het
Aph1b A T 9: 66,794,113 C81S probably benign Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Arhgef28 A T 13: 97,994,132 H399Q probably benign Het
Asic5 A G 3: 82,011,987 E304G probably benign Het
B4galnt4 A G 7: 141,070,533 Y771C probably damaging Het
Birc2 G T 9: 7,819,517 Q465K probably benign Het
Btla C T 16: 45,250,374 T232I probably damaging Het
Ccdc84 A G 9: 44,417,721 C66R probably damaging Het
Ccl7 G T 11: 82,046,552 K37N probably benign Het
Cdk17 T C 10: 93,226,105 V233A probably damaging Het
Cilp2 C A 8: 69,881,323 Q1008H probably damaging Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Clcnka T C 4: 141,392,802 T269A probably damaging Het
Col12a1 A T 9: 79,627,103 probably null Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cyp3a25 T C 5: 145,994,929 D123G probably damaging Het
D630003M21Rik A T 2: 158,203,185 L808Q probably damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx15 T C 5: 52,184,701 T92A possibly damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Diaph2 G A X: 129,960,127 R473Q probably damaging Het
Dnd1 A G 18: 36,766,004 C11R possibly damaging Het
Dock1 A C 7: 135,146,507 D1566A probably benign Het
Drp2 A G X: 134,427,115 I43V probably benign Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Emilin1 A G 5: 30,918,590 E725G probably damaging Het
Eml2 A G 7: 19,201,878 Y487C probably damaging Het
Epg5 T A 18: 77,975,031 L919H probably damaging Het
Fam187a T A 11: 102,886,011 S214T probably damaging Het
Flna T C X: 74,240,263 T521A probably benign Het
Foxi1 T A 11: 34,207,531 I165F probably damaging Het
Fxr2 A T 11: 69,652,277 K633N probably benign Het
Gdpd5 T C 7: 99,448,999 I209T probably benign Het
Gm13212 A T 4: 145,622,428 Q145L possibly damaging Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Grm7 A T 6: 111,080,423 D328V probably benign Het
Heatr6 T C 11: 83,769,230 S534P probably damaging Het
Heph A G X: 96,529,486 T792A probably damaging Het
Hipk2 T A 6: 38,718,935 probably null Het
Hps3 T A 3: 20,019,959 probably null Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Insc T C 7: 114,842,178 I409T probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Kcnma1 T A 14: 23,803,162 Q108L probably damaging Het
Klc3 A G 7: 19,398,041 V137A probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Lgr4 T A 2: 110,011,397 F576I possibly damaging Het
Lypd6b A G 2: 49,947,447 I144V possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Mitf A T 6: 98,010,422 N159I probably damaging Het
Morc1 T C 16: 48,592,530 I678T probably benign Het
Muc4 A G 16: 32,756,251 probably benign Het
Myo7a T C 7: 98,052,256 Y2115C probably damaging Het
Myof T C 19: 37,986,705 I182V probably benign Het
Ncor1 A G 11: 62,381,419 V635A probably damaging Het
Neb G T 2: 52,212,760 Y4257* probably null Het
Npr2 T A 4: 43,641,258 V428E probably benign Het
Nufip2 A G 11: 77,692,298 D346G probably damaging Het
Olfr1262 T A 2: 90,002,481 V25E probably benign Het
Olfr1282 C T 2: 111,335,707 V124M possibly damaging Het
Olfr204 A G 16: 59,315,015 Y131H probably damaging Het
Olfr705 T C 7: 106,713,823 N286S possibly damaging Het
Olfr877 T A 9: 37,855,264 Y149N probably damaging Het
Olfr982 T G 9: 40,074,785 I163M possibly damaging Het
Pdgfrb G A 18: 61,071,717 V550I probably benign Het
Pi4ka A T 16: 17,367,525 L237* probably null Het
Pla2r1 G A 2: 60,428,711 T1111M probably benign Het
Plxnd1 A T 6: 115,969,441 probably null Het
Pnp G C 14: 50,947,973 A67P probably benign Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prom2 T C 2: 127,539,787 D203G probably benign Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rnf115 A G 3: 96,727,837 probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rusc2 C A 4: 43,421,719 A713D possibly damaging Het
Ryr3 A T 2: 112,730,328 H3009Q possibly damaging Het
Serpina1d C A 12: 103,767,997 C16F probably benign Het
Serpinf2 G T 11: 75,437,483 R80S possibly damaging Het
Sh2d4a C A 8: 68,329,315 Q192K probably benign Het
Sh3d21 T A 4: 126,150,936 probably null Het
Sh3rf2 T A 18: 42,053,981 L55Q probably damaging Het
Shc4 T C 2: 125,639,367 D255G probably damaging Het
Skint2 T A 4: 112,625,909 H170Q probably benign Het
Slc29a4 A G 5: 142,717,754 Y261C probably damaging Het
Slc35a5 A T 16: 45,143,708 N102K possibly damaging Het
Slc38a3 A T 9: 107,655,953 I307K probably damaging Het
Sv2b A T 7: 75,124,080 S548T probably benign Het
Tgfbi T C 13: 56,632,881 S524P probably benign Het
Tgm5 T C 2: 121,075,218 D152G probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Trpm1 A G 7: 64,268,016 K1258R probably damaging Het
Ttc22 T C 4: 106,636,806 V321A probably benign Het
Ube2c C A 2: 164,770,023 A15E probably benign Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Umod A T 7: 119,463,255 L631M probably damaging Het
Ush1c G A 7: 46,219,392 Q373* probably null Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Wnt8b T C 19: 44,493,590 L14P probably benign Het
Wrn G A 8: 33,288,864 A563V probably damaging Het
Zfp608 A G 18: 54,897,911 S986P probably benign Het
Znrf3 T C 11: 5,283,373 H228R possibly damaging Het
Other mutations in Obsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Obsl1 APN 1 75490874 missense probably benign 0.02
IGL01111:Obsl1 APN 1 75497145 missense possibly damaging 0.62
IGL01140:Obsl1 APN 1 75489756 unclassified probably benign
IGL02149:Obsl1 APN 1 75503820 missense probably damaging 1.00
IGL02225:Obsl1 APN 1 75503798 missense probably damaging 0.99
IGL02269:Obsl1 APN 1 75487713 missense probably damaging 0.97
IGL02296:Obsl1 APN 1 75498149 missense possibly damaging 0.94
IGL02386:Obsl1 APN 1 75492517 missense probably damaging 1.00
IGL02408:Obsl1 APN 1 75505246 missense probably damaging 0.98
IGL02601:Obsl1 APN 1 75489620 missense probably benign
IGL03053:Obsl1 APN 1 75493079 missense probably benign
IGL03181:Obsl1 APN 1 75492584 missense probably benign 0.00
IGL03402:Obsl1 APN 1 75486799 missense probably benign 0.00
PIT1430001:Obsl1 UTSW 1 75506167 missense probably damaging 1.00
R0281:Obsl1 UTSW 1 75492927 missense probably damaging 1.00
R1343:Obsl1 UTSW 1 75492579 missense probably damaging 1.00
R1394:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1395:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1439:Obsl1 UTSW 1 75486784 nonsense probably null
R1456:Obsl1 UTSW 1 75487656 nonsense probably null
R1728:Obsl1 UTSW 1 75486756 missense probably benign
R1729:Obsl1 UTSW 1 75486756 missense probably benign
R1730:Obsl1 UTSW 1 75486756 missense probably benign
R1739:Obsl1 UTSW 1 75486756 missense probably benign
R1757:Obsl1 UTSW 1 75493883 missense probably benign
R1762:Obsl1 UTSW 1 75486756 missense probably benign
R1783:Obsl1 UTSW 1 75486756 missense probably benign
R1784:Obsl1 UTSW 1 75486756 missense probably benign
R1785:Obsl1 UTSW 1 75486756 missense probably benign
R1851:Obsl1 UTSW 1 75492893 missense probably damaging 1.00
R1873:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1875:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1980:Obsl1 UTSW 1 75505836 missense probably damaging 1.00
R1985:Obsl1 UTSW 1 75505600 missense probably damaging 1.00
R2049:Obsl1 UTSW 1 75486756 missense probably benign
R2069:Obsl1 UTSW 1 75486756 missense probably benign
R2122:Obsl1 UTSW 1 75493883 missense probably benign
R2141:Obsl1 UTSW 1 75486756 missense probably benign
R2142:Obsl1 UTSW 1 75486756 missense probably benign
R2184:Obsl1 UTSW 1 75502217 missense probably benign 0.26
R2267:Obsl1 UTSW 1 75505698 missense probably damaging 1.00
R2883:Obsl1 UTSW 1 75496511 missense possibly damaging 0.73
R3079:Obsl1 UTSW 1 75490823 missense probably damaging 1.00
R3749:Obsl1 UTSW 1 75498246 missense probably benign
R4002:Obsl1 UTSW 1 75500099 missense possibly damaging 0.90
R4365:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4366:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4414:Obsl1 UTSW 1 75490902 missense probably benign 0.00
R4700:Obsl1 UTSW 1 75503441 missense probably damaging 1.00
R4799:Obsl1 UTSW 1 75489501 missense possibly damaging 0.93
R5081:Obsl1 UTSW 1 75487963 missense possibly damaging 0.49
R5389:Obsl1 UTSW 1 75503261 intron probably benign
R5757:Obsl1 UTSW 1 75493055 missense probably damaging 0.98
R5890:Obsl1 UTSW 1 75493859 missense probably damaging 1.00
R5946:Obsl1 UTSW 1 75491207 missense probably damaging 0.96
R6005:Obsl1 UTSW 1 75492215 unclassified probably null
R6118:Obsl1 UTSW 1 75492078 intron probably benign
R6154:Obsl1 UTSW 1 75500144 missense probably benign 0.19
R6317:Obsl1 UTSW 1 75489629 missense possibly damaging 0.50
R6379:Obsl1 UTSW 1 75503143 missense probably damaging 1.00
R6387:Obsl1 UTSW 1 75491362 missense probably benign 0.03
R7084:Obsl1 UTSW 1 75487750 missense not run
R7123:Obsl1 UTSW 1 75489669 missense not run
V8831:Obsl1 UTSW 1 75486756 missense probably benign
X0061:Obsl1 UTSW 1 75486768 missense probably benign
Z1088:Obsl1 UTSW 1 75486756 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATACTCCCCGGCATCCTCA -3'
(R):5'- CTAATGAGAGGTGAATGGGGTTT -3'

Sequencing Primer
(F):5'- ATCCTCAGGCTGGGCGTG -3'
(R):5'- AATGGGGTTTGAGTATGAGTCTGAC -3'
Posted On2014-06-30