Incidental Mutation 'R1864:Lcn2'
ID208446
Institutional Source Beutler Lab
Gene Symbol Lcn2
Ensembl Gene ENSMUSG00000026822
Gene Namelipocalin 2
SynonymsNGAL, 24p3
MMRRC Submission 039887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1864 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32384633-32388252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32385422 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 194 (T194A)
Ref Sequence ENSEMBL: ENSMUSP00000053962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048792] [ENSMUST00000050785] [ENSMUST00000146423] [ENSMUST00000192241]
PDB Structure
Crystal Structure of Murine Siderocalin (Lipocalin 2, 24p3) [X-RAY DIFFRACTION]
Crystal Structure of Murine Siderocalin in Complex with an Fab Fragment [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000048792
SMART Domains Protein: ENSMUSP00000038970
Gene: ENSMUSG00000039195

DomainStartEndE-ValueType
Pfam:UPF0184 1 83 5.5e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000050785
AA Change: T194A

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053962
Gene: ENSMUSG00000026822
AA Change: T194A

DomainStartEndE-ValueType
Pfam:Lipocalin 48 195 2.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144569
Predicted Effect probably benign
Transcript: ENSMUST00000146423
SMART Domains Protein: ENSMUSP00000142021
Gene: ENSMUSG00000039195

DomainStartEndE-ValueType
Pfam:UPF0184 1 43 1.4e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155830
Predicted Effect probably benign
Transcript: ENSMUST00000192241
SMART Domains Protein: ENSMUSP00000141430
Gene: ENSMUSG00000026822

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Pfam:Lipocalin 134 271 5.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192758
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the lipocalin family. Members of this family transport small hydrophobic molecules such as lipids, steroid hormones and retinoids. The protein encoded by this gene is a neutrophil gelatinase-associated lipocalin and plays a role in innate immunity by limiting bacterial growth as a result of sequestering iron-containing siderophores. The presence of this protein in blood and urine is an early biomarker of acute kidney injury. This protein is thought to be be involved in multiple cellular processes, including maintenance of skin homeostasis, and suppression of invasiveness and metastasis. Mice lacking this gene are more susceptible to bacterial infection than wild type mice. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants are more susceptible to infection with bacteria that utilize enterochelin-type siderophores to acquire iron and impaired thermogenesis. Mice homozygous for another knock-out allele exhibit apoptotic defects in hematopoietic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agtpbp1 A G 13: 59,450,202 Y1198H possibly damaging Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
AI314180 T A 4: 58,849,942 H427L possibly damaging Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ankrd50 A T 3: 38,454,461 N329K probably benign Het
Ano4 C A 10: 88,971,391 G741V probably damaging Het
Anxa1 T C 19: 20,379,689 D191G probably benign Het
Apc2 C T 10: 80,313,648 T1512I probably damaging Het
Aph1b A T 9: 66,794,113 C81S probably benign Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Arhgef28 A T 13: 97,994,132 H399Q probably benign Het
Asic5 A G 3: 82,011,987 E304G probably benign Het
B4galnt4 A G 7: 141,070,533 Y771C probably damaging Het
Birc2 G T 9: 7,819,517 Q465K probably benign Het
Btla C T 16: 45,250,374 T232I probably damaging Het
Ccdc84 A G 9: 44,417,721 C66R probably damaging Het
Ccl7 G T 11: 82,046,552 K37N probably benign Het
Cdk17 T C 10: 93,226,105 V233A probably damaging Het
Cilp2 C A 8: 69,881,323 Q1008H probably damaging Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Clcnka T C 4: 141,392,802 T269A probably damaging Het
Col12a1 A T 9: 79,627,103 probably null Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cyp3a25 T C 5: 145,994,929 D123G probably damaging Het
D630003M21Rik A T 2: 158,203,185 L808Q probably damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx15 T C 5: 52,184,701 T92A possibly damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Diaph2 G A X: 129,960,127 R473Q probably damaging Het
Dnd1 A G 18: 36,766,004 C11R possibly damaging Het
Dock1 A C 7: 135,146,507 D1566A probably benign Het
Drp2 A G X: 134,427,115 I43V probably benign Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Emilin1 A G 5: 30,918,590 E725G probably damaging Het
Eml2 A G 7: 19,201,878 Y487C probably damaging Het
Epg5 T A 18: 77,975,031 L919H probably damaging Het
Fam187a T A 11: 102,886,011 S214T probably damaging Het
Flna T C X: 74,240,263 T521A probably benign Het
Foxi1 T A 11: 34,207,531 I165F probably damaging Het
Fxr2 A T 11: 69,652,277 K633N probably benign Het
Gdpd5 T C 7: 99,448,999 I209T probably benign Het
Gm13212 A T 4: 145,622,428 Q145L possibly damaging Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Grm7 A T 6: 111,080,423 D328V probably benign Het
Heatr6 T C 11: 83,769,230 S534P probably damaging Het
Heph A G X: 96,529,486 T792A probably damaging Het
Hipk2 T A 6: 38,718,935 probably null Het
Hps3 T A 3: 20,019,959 probably null Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Insc T C 7: 114,842,178 I409T probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Kcnma1 T A 14: 23,803,162 Q108L probably damaging Het
Klc3 A G 7: 19,398,041 V137A probably damaging Het
Lgr4 T A 2: 110,011,397 F576I possibly damaging Het
Lypd6b A G 2: 49,947,447 I144V possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Mitf A T 6: 98,010,422 N159I probably damaging Het
Morc1 T C 16: 48,592,530 I678T probably benign Het
Muc4 A G 16: 32,756,251 probably benign Het
Myo7a T C 7: 98,052,256 Y2115C probably damaging Het
Myof T C 19: 37,986,705 I182V probably benign Het
Ncor1 A G 11: 62,381,419 V635A probably damaging Het
Neb G T 2: 52,212,760 Y4257* probably null Het
Npr2 T A 4: 43,641,258 V428E probably benign Het
Nufip2 A G 11: 77,692,298 D346G probably damaging Het
Obsl1 G A 1: 75,493,109 S1088F probably benign Het
Olfr1262 T A 2: 90,002,481 V25E probably benign Het
Olfr1282 C T 2: 111,335,707 V124M possibly damaging Het
Olfr204 A G 16: 59,315,015 Y131H probably damaging Het
Olfr705 T C 7: 106,713,823 N286S possibly damaging Het
Olfr877 T A 9: 37,855,264 Y149N probably damaging Het
Olfr982 T G 9: 40,074,785 I163M possibly damaging Het
Pdgfrb G A 18: 61,071,717 V550I probably benign Het
Pi4ka A T 16: 17,367,525 L237* probably null Het
Pla2r1 G A 2: 60,428,711 T1111M probably benign Het
Plxnd1 A T 6: 115,969,441 probably null Het
Pnp G C 14: 50,947,973 A67P probably benign Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prom2 T C 2: 127,539,787 D203G probably benign Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rnf115 A G 3: 96,727,837 probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rusc2 C A 4: 43,421,719 A713D possibly damaging Het
Ryr3 A T 2: 112,730,328 H3009Q possibly damaging Het
Serpina1d C A 12: 103,767,997 C16F probably benign Het
Serpinf2 G T 11: 75,437,483 R80S possibly damaging Het
Sh2d4a C A 8: 68,329,315 Q192K probably benign Het
Sh3d21 T A 4: 126,150,936 probably null Het
Sh3rf2 T A 18: 42,053,981 L55Q probably damaging Het
Shc4 T C 2: 125,639,367 D255G probably damaging Het
Skint2 T A 4: 112,625,909 H170Q probably benign Het
Slc29a4 A G 5: 142,717,754 Y261C probably damaging Het
Slc35a5 A T 16: 45,143,708 N102K possibly damaging Het
Slc38a3 A T 9: 107,655,953 I307K probably damaging Het
Sv2b A T 7: 75,124,080 S548T probably benign Het
Tgfbi T C 13: 56,632,881 S524P probably benign Het
Tgm5 T C 2: 121,075,218 D152G probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Trpm1 A G 7: 64,268,016 K1258R probably damaging Het
Ttc22 T C 4: 106,636,806 V321A probably benign Het
Ube2c C A 2: 164,770,023 A15E probably benign Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Umod A T 7: 119,463,255 L631M probably damaging Het
Ush1c G A 7: 46,219,392 Q373* probably null Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Wnt8b T C 19: 44,493,590 L14P probably benign Het
Wrn G A 8: 33,288,864 A563V probably damaging Het
Zfp608 A G 18: 54,897,911 S986P probably benign Het
Znrf3 T C 11: 5,283,373 H228R possibly damaging Het
Other mutations in Lcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00935:Lcn2 APN 2 32387578 critical splice donor site probably null
IGL01327:Lcn2 APN 2 32386018 missense possibly damaging 0.62
IGL01913:Lcn2 APN 2 32387145 missense possibly damaging 0.46
IGL02108:Lcn2 APN 2 32387605 missense probably damaging 0.99
IGL02215:Lcn2 APN 2 32384865 makesense probably null
IGL02577:Lcn2 APN 2 32387089 missense probably damaging 0.97
IGL03129:Lcn2 APN 2 32387704 missense possibly damaging 0.70
R0302:Lcn2 UTSW 2 32384889 unclassified probably benign
R1865:Lcn2 UTSW 2 32385422 missense possibly damaging 0.77
R4093:Lcn2 UTSW 2 32387716 start codon destroyed probably null 1.00
R4621:Lcn2 UTSW 2 32384643 unclassified probably benign
R5236:Lcn2 UTSW 2 32385961 missense probably benign 0.06
R5716:Lcn2 UTSW 2 32385813 missense possibly damaging 0.88
R6785:Lcn2 UTSW 2 32387027 critical splice donor site probably null
R7059:Lcn2 UTSW 2 32387596 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTGGACAGGAATCTGGACTCC -3'
(R):5'- TCTTCTGCAGACCTCCACAG -3'

Sequencing Primer
(F):5'- AGGAATCTGGACTCCTCATCAGG -3'
(R):5'- CCACAGATAACAAGTCTGAGGG -3'
Posted On2014-06-30