Incidental Mutation 'R1864:Lgr4'
ID208452
Institutional Source Beutler Lab
Gene Symbol Lgr4
Ensembl Gene ENSMUSG00000050199
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 4
SynonymsA930009A08Rik, Gpr48, A330106J01Rik
MMRRC Submission 039887-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1864 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location109917647-110014257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110011397 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 576 (F576I)
Ref Sequence ENSEMBL: ENSMUSP00000047325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046548] [ENSMUST00000111037]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046548
AA Change: F576I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047325
Gene: ENSMUSG00000050199
AA Change: F576I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 1.49e1 SMART
LRR 80 103 1.99e0 SMART
LRR_TYP 104 127 2.75e-3 SMART
LRR_TYP 128 151 2.79e-4 SMART
LRR 152 175 2.54e1 SMART
LRR 176 199 4.65e-1 SMART
LRR_TYP 200 223 1.04e-3 SMART
LRR 224 246 6.4e0 SMART
LRR_TYP 247 270 5.99e-4 SMART
LRR 272 294 9.77e1 SMART
LRR 318 341 3e1 SMART
LRR 343 363 4.71e1 SMART
LRR 364 387 1.49e1 SMART
LRR_TYP 388 411 1.15e-5 SMART
LRR 412 435 3.98e1 SMART
low complexity region 500 516 N/A INTRINSIC
Pfam:7tm_1 555 801 2.7e-10 PFAM
low complexity region 824 837 N/A INTRINSIC
low complexity region 910 924 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111037
AA Change: F552I

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106666
Gene: ENSMUSG00000050199
AA Change: F552I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 9.77e1 SMART
LRR_TYP 80 103 2.75e-3 SMART
LRR_TYP 104 127 2.79e-4 SMART
LRR 128 151 2.54e1 SMART
LRR 152 175 4.65e-1 SMART
LRR_TYP 176 199 1.04e-3 SMART
LRR 200 222 6.4e0 SMART
LRR_TYP 223 246 5.99e-4 SMART
LRR 248 270 9.77e1 SMART
LRR 294 317 3e1 SMART
LRR 319 339 4.71e1 SMART
LRR 340 363 1.49e1 SMART
LRR_TYP 364 387 1.15e-5 SMART
LRR 388 411 3.98e1 SMART
low complexity region 476 492 N/A INTRINSIC
Pfam:7tm_1 531 777 9.3e-17 PFAM
low complexity region 800 813 N/A INTRINSIC
low complexity region 886 900 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor that binds R-spondins and activates the Wnt signaling pathway. This Wnt signaling pathway activation is necessary for proper development of many organs of the body. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a knock-out allele show embryonic and perinatal death, open eyelids, and abnormal renal development. One gene trap mutation leads to reduced body weight, sterility, and impaired male reproductive tract development. Another gene trap mutation causes ocular anterior segment anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agtpbp1 A G 13: 59,450,202 Y1198H possibly damaging Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
AI314180 T A 4: 58,849,942 H427L possibly damaging Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ankrd50 A T 3: 38,454,461 N329K probably benign Het
Ano4 C A 10: 88,971,391 G741V probably damaging Het
Anxa1 T C 19: 20,379,689 D191G probably benign Het
Apc2 C T 10: 80,313,648 T1512I probably damaging Het
Aph1b A T 9: 66,794,113 C81S probably benign Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Arhgef28 A T 13: 97,994,132 H399Q probably benign Het
Asic5 A G 3: 82,011,987 E304G probably benign Het
B4galnt4 A G 7: 141,070,533 Y771C probably damaging Het
Birc2 G T 9: 7,819,517 Q465K probably benign Het
Btla C T 16: 45,250,374 T232I probably damaging Het
Ccdc84 A G 9: 44,417,721 C66R probably damaging Het
Ccl7 G T 11: 82,046,552 K37N probably benign Het
Cdk17 T C 10: 93,226,105 V233A probably damaging Het
Cilp2 C A 8: 69,881,323 Q1008H probably damaging Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Clcnka T C 4: 141,392,802 T269A probably damaging Het
Col12a1 A T 9: 79,627,103 probably null Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cyp3a25 T C 5: 145,994,929 D123G probably damaging Het
D630003M21Rik A T 2: 158,203,185 L808Q probably damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx15 T C 5: 52,184,701 T92A possibly damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Diaph2 G A X: 129,960,127 R473Q probably damaging Het
Dnd1 A G 18: 36,766,004 C11R possibly damaging Het
Dock1 A C 7: 135,146,507 D1566A probably benign Het
Drp2 A G X: 134,427,115 I43V probably benign Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Emilin1 A G 5: 30,918,590 E725G probably damaging Het
Eml2 A G 7: 19,201,878 Y487C probably damaging Het
Epg5 T A 18: 77,975,031 L919H probably damaging Het
Fam187a T A 11: 102,886,011 S214T probably damaging Het
Flna T C X: 74,240,263 T521A probably benign Het
Foxi1 T A 11: 34,207,531 I165F probably damaging Het
Fxr2 A T 11: 69,652,277 K633N probably benign Het
Gdpd5 T C 7: 99,448,999 I209T probably benign Het
Gm13212 A T 4: 145,622,428 Q145L possibly damaging Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Grm7 A T 6: 111,080,423 D328V probably benign Het
Heatr6 T C 11: 83,769,230 S534P probably damaging Het
Heph A G X: 96,529,486 T792A probably damaging Het
Hipk2 T A 6: 38,718,935 probably null Het
Hps3 T A 3: 20,019,959 probably null Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Insc T C 7: 114,842,178 I409T probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Kcnma1 T A 14: 23,803,162 Q108L probably damaging Het
Klc3 A G 7: 19,398,041 V137A probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Lypd6b A G 2: 49,947,447 I144V possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Mitf A T 6: 98,010,422 N159I probably damaging Het
Morc1 T C 16: 48,592,530 I678T probably benign Het
Muc4 A G 16: 32,756,251 probably benign Het
Myo7a T C 7: 98,052,256 Y2115C probably damaging Het
Myof T C 19: 37,986,705 I182V probably benign Het
Ncor1 A G 11: 62,381,419 V635A probably damaging Het
Neb G T 2: 52,212,760 Y4257* probably null Het
Npr2 T A 4: 43,641,258 V428E probably benign Het
Nufip2 A G 11: 77,692,298 D346G probably damaging Het
Obsl1 G A 1: 75,493,109 S1088F probably benign Het
Olfr1262 T A 2: 90,002,481 V25E probably benign Het
Olfr1282 C T 2: 111,335,707 V124M possibly damaging Het
Olfr204 A G 16: 59,315,015 Y131H probably damaging Het
Olfr705 T C 7: 106,713,823 N286S possibly damaging Het
Olfr877 T A 9: 37,855,264 Y149N probably damaging Het
Olfr982 T G 9: 40,074,785 I163M possibly damaging Het
Pdgfrb G A 18: 61,071,717 V550I probably benign Het
Pi4ka A T 16: 17,367,525 L237* probably null Het
Pla2r1 G A 2: 60,428,711 T1111M probably benign Het
Plxnd1 A T 6: 115,969,441 probably null Het
Pnp G C 14: 50,947,973 A67P probably benign Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prom2 T C 2: 127,539,787 D203G probably benign Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rnf115 A G 3: 96,727,837 probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rusc2 C A 4: 43,421,719 A713D possibly damaging Het
Ryr3 A T 2: 112,730,328 H3009Q possibly damaging Het
Serpina1d C A 12: 103,767,997 C16F probably benign Het
Serpinf2 G T 11: 75,437,483 R80S possibly damaging Het
Sh2d4a C A 8: 68,329,315 Q192K probably benign Het
Sh3d21 T A 4: 126,150,936 probably null Het
Sh3rf2 T A 18: 42,053,981 L55Q probably damaging Het
Shc4 T C 2: 125,639,367 D255G probably damaging Het
Skint2 T A 4: 112,625,909 H170Q probably benign Het
Slc29a4 A G 5: 142,717,754 Y261C probably damaging Het
Slc35a5 A T 16: 45,143,708 N102K possibly damaging Het
Slc38a3 A T 9: 107,655,953 I307K probably damaging Het
Sv2b A T 7: 75,124,080 S548T probably benign Het
Tgfbi T C 13: 56,632,881 S524P probably benign Het
Tgm5 T C 2: 121,075,218 D152G probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Trpm1 A G 7: 64,268,016 K1258R probably damaging Het
Ttc22 T C 4: 106,636,806 V321A probably benign Het
Ube2c C A 2: 164,770,023 A15E probably benign Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Umod A T 7: 119,463,255 L631M probably damaging Het
Ush1c G A 7: 46,219,392 Q373* probably null Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Wnt8b T C 19: 44,493,590 L14P probably benign Het
Wrn G A 8: 33,288,864 A563V probably damaging Het
Zfp608 A G 18: 54,897,911 S986P probably benign Het
Znrf3 T C 11: 5,283,373 H228R possibly damaging Het
Other mutations in Lgr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Lgr4 APN 2 110011290 missense probably damaging 1.00
IGL02247:Lgr4 APN 2 110002501 missense probably benign
IGL02247:Lgr4 APN 2 110008075 splice site probably benign
IGL02302:Lgr4 APN 2 110002496 missense probably damaging 0.99
IGL02309:Lgr4 APN 2 110012535 utr 3 prime probably benign
IGL02511:Lgr4 APN 2 110011272 missense probably benign 0.06
IGL02604:Lgr4 APN 2 110011313 missense probably damaging 1.00
IGL02648:Lgr4 APN 2 110012373 missense probably damaging 1.00
IGL02795:Lgr4 APN 2 110008210 splice site probably benign
IGL02899:Lgr4 APN 2 109918253 missense probably damaging 0.99
R0003:Lgr4 UTSW 2 109997665 critical splice donor site probably null
R0200:Lgr4 UTSW 2 109970690 critical splice acceptor site probably null
R0314:Lgr4 UTSW 2 109991093 splice site probably benign
R0482:Lgr4 UTSW 2 110008092 missense probably damaging 1.00
R0491:Lgr4 UTSW 2 110007281 splice site probably benign
R0517:Lgr4 UTSW 2 110011320 missense probably damaging 1.00
R0546:Lgr4 UTSW 2 109999421 missense probably damaging 0.98
R0658:Lgr4 UTSW 2 110011787 missense possibly damaging 0.83
R1367:Lgr4 UTSW 2 109991135 missense probably damaging 0.98
R1977:Lgr4 UTSW 2 110011928 missense probably damaging 1.00
R2239:Lgr4 UTSW 2 110012393 missense probably damaging 1.00
R2380:Lgr4 UTSW 2 110012393 missense probably damaging 1.00
R2383:Lgr4 UTSW 2 110000615 missense probably damaging 1.00
R2997:Lgr4 UTSW 2 110003517 missense probably benign 0.30
R3707:Lgr4 UTSW 2 109970754 missense probably damaging 0.99
R3803:Lgr4 UTSW 2 110008197 missense probably benign 0.10
R3804:Lgr4 UTSW 2 110008197 missense probably benign 0.10
R3843:Lgr4 UTSW 2 109996773 splice site probably benign
R4030:Lgr4 UTSW 2 109989751 missense probably benign 0.06
R4513:Lgr4 UTSW 2 110012016 missense possibly damaging 0.93
R4777:Lgr4 UTSW 2 109996682 missense probably damaging 0.98
R4912:Lgr4 UTSW 2 110006502 critical splice acceptor site probably null
R4994:Lgr4 UTSW 2 110011938 missense probably damaging 0.99
R5106:Lgr4 UTSW 2 109997595 missense probably damaging 0.97
R5131:Lgr4 UTSW 2 110012333 missense probably benign
R5152:Lgr4 UTSW 2 110000603 missense probably damaging 1.00
R5753:Lgr4 UTSW 2 110002512 nonsense probably null
R5860:Lgr4 UTSW 2 109991151 missense probably damaging 0.96
R5914:Lgr4 UTSW 2 109918272 missense possibly damaging 0.78
R6145:Lgr4 UTSW 2 110007243 nonsense probably null
R6263:Lgr4 UTSW 2 110011898 missense possibly damaging 0.95
R6400:Lgr4 UTSW 2 109991133 missense probably damaging 0.98
X0053:Lgr4 UTSW 2 110011437 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CGCTTATCACCAGACCATAATATTCAG -3'
(R):5'- TAACAGGAATACGGCGCTCTC -3'

Sequencing Primer
(F):5'- CACCAGACCATAATATTCAGTGTTC -3'
(R):5'- TCTCTGAGGAGAAGACTGCC -3'
Posted On2014-06-30