Incidental Mutation 'R0116:Vav1'
ID20846
Institutional Source Beutler Lab
Gene Symbol Vav1
Ensembl Gene ENSMUSG00000034116
Gene Namevav 1 oncogene
Synonyms
MMRRC Submission 038402-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R0116 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location57279100-57328031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57296039 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 88 (L88F)
Ref Sequence ENSEMBL: ENSMUSP00000108491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005889] [ENSMUST00000112870] [ENSMUST00000169220]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005889
AA Change: L88F

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116
AA Change: L88F

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 669 751 8.88e-25 SMART
SH3 785 841 1.44e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112870
AA Change: L88F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116
AA Change: L88F

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 633 712 3.93e-2 SMART
SH3 746 802 1.44e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169220
AA Change: L64F

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116
AA Change: L64F

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 27 79 6.2e-11 PFAM
RhoGEF 174 348 7.89e-62 SMART
PH 379 482 8.45e-12 SMART
C1 492 540 3.67e-9 SMART
SH3 571 635 1.65e-8 SMART
SH2 645 727 8.88e-25 SMART
SH3 761 817 1.44e-22 SMART
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 94% (95/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,290,770 V152E probably damaging Het
Abca5 T G 11: 110,276,505 E1495A probably damaging Het
Abcc12 G A 8: 86,534,998 S668F probably benign Het
Adgrl4 A T 3: 151,517,610 T608S probably benign Het
Angel2 G A 1: 190,940,990 D255N probably benign Het
Apob T A 12: 7,989,113 probably benign Het
Arfgef2 A T 2: 166,873,683 R1349S probably damaging Het
Atp2b2 C T 6: 113,793,695 V418I probably damaging Het
Birc6 C A 17: 74,623,746 probably benign Het
Capn13 T A 17: 73,351,524 Y183F probably damaging Het
Cngb1 A G 8: 95,260,638 S352P probably damaging Het
Col6a3 A G 1: 90,813,551 S720P probably damaging Het
Cpa4 C T 6: 30,579,658 R155W probably damaging Het
Dapk1 A G 13: 60,761,100 I1176V probably benign Het
Dnah17 T C 11: 118,058,306 E2959G probably benign Het
Dnah7b T A 1: 46,213,360 I1734N possibly damaging Het
Dnajb7 A G 15: 81,407,354 Y261H probably benign Het
Dock2 T C 11: 34,688,565 probably benign Het
Dusp27 A C 1: 166,099,701 S781A probably benign Het
Dyrk3 A T 1: 131,129,839 V199E probably damaging Het
F2r G T 13: 95,604,486 C180* probably null Het
F5 A G 1: 164,184,914 S466G probably benign Het
Fbn2 A T 18: 58,102,373 C677* probably null Het
Fbxo41 A G 6: 85,477,908 S673P probably damaging Het
Fhad1 G T 4: 141,940,095 H639N probably benign Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Foxa2 A G 2: 148,043,561 S270P probably damaging Het
Fxyd7 C T 7: 31,047,368 probably null Het
Gm5225 A G 17: 24,024,058 D67G probably benign Het
Grik3 G A 4: 125,670,556 E444K probably benign Het
Gsdma2 A G 11: 98,649,183 K44E probably damaging Het
Haus1 T A 18: 77,762,070 K130* probably null Het
Heg1 A G 16: 33,735,658 probably benign Het
Hormad2 A G 11: 4,412,206 probably benign Het
Hsd17b3 G A 13: 64,058,589 R300C possibly damaging Het
Irf5 T C 6: 29,536,109 F374S probably damaging Het
Itch A G 2: 155,217,983 probably benign Het
Jade2 A T 11: 51,831,309 L139Q probably damaging Het
Kif5c G A 2: 49,752,239 probably benign Het
Lama1 T C 17: 67,776,923 Y1387H probably benign Het
Larp4b A G 13: 9,170,688 R658G probably damaging Het
Mcph1 C T 8: 18,788,248 L729F probably benign Het
Me1 A T 9: 86,654,667 N118K probably benign Het
Med13 A G 11: 86,319,897 L473S probably damaging Het
Mgam T A 6: 40,658,987 Y359N probably damaging Het
Morc2b A G 17: 33,137,041 S586P probably damaging Het
Mthfr A G 4: 148,051,523 D310G probably benign Het
Mtmr7 A T 8: 40,581,405 probably benign Het
Mtus1 A G 8: 40,998,477 probably benign Het
Mus81 G T 19: 5,486,524 A138D probably damaging Het
Myom2 A T 8: 15,117,633 I1073F probably damaging Het
Nhsl1 A T 10: 18,525,242 K739* probably null Het
Nlrp4d T A 7: 10,374,891 K762N probably benign Het
Nrap T C 19: 56,355,546 Y724C probably damaging Het
Ogn A T 13: 49,621,038 Y219F possibly damaging Het
Olfr805 T A 10: 129,722,977 D189V probably damaging Het
Olfr923 T C 9: 38,828,564 L291P probably damaging Het
Olfr948 A T 9: 39,318,864 I250N probably damaging Het
Padi2 T C 4: 140,926,239 V180A probably benign Het
Papss2 C T 19: 32,638,368 R167* probably null Het
Pcbp2 T C 15: 102,474,235 probably benign Het
Per1 T A 11: 69,101,880 probably benign Het
Pik3ca T C 3: 32,459,945 I860T probably damaging Het
Pkdrej G A 15: 85,817,545 Q1397* probably null Het
Plce1 T C 19: 38,721,821 V1133A probably benign Het
Pnmal1 T G 7: 16,960,700 V160G probably damaging Het
Prss12 T C 3: 123,482,774 C351R probably damaging Het
Qprt A T 7: 127,109,097 L54Q probably damaging Het
Raf1 C T 6: 115,626,383 S165N probably damaging Het
Rere A G 4: 150,616,976 N1271S probably benign Het
Rnasel T A 1: 153,754,512 L258H probably damaging Het
Ryr2 T C 13: 11,709,921 D2502G probably damaging Het
Ryr3 G A 2: 112,803,165 S2081L probably damaging Het
Sc5d G T 9: 42,259,859 Y11* probably null Het
Slc25a29 A C 12: 108,827,091 L187R possibly damaging Het
Slc2a7 G A 4: 150,168,264 V454M probably benign Het
Slco1b2 A T 6: 141,669,388 T340S probably benign Het
Smarcc1 A G 9: 110,147,104 N153S possibly damaging Het
Snx1 C A 9: 66,088,539 E516* probably null Het
Sptlc2 T C 12: 87,356,680 D115G probably benign Het
Stard9 A G 2: 120,634,255 N67S probably damaging Het
Swap70 G A 7: 110,273,282 R368H probably benign Het
Tcaf3 T C 6: 42,591,350 K691E probably benign Het
Tmco4 T C 4: 139,053,920 F465S probably damaging Het
Tmem245 A G 4: 56,926,213 S290P probably benign Het
Top2a T C 11: 99,003,590 T972A probably benign Het
Tpr T A 1: 150,410,147 S527R probably damaging Het
Traf2 T C 2: 25,519,609 D443G probably damaging Het
Trim40 A T 17: 36,883,147 probably null Het
Trim42 A T 9: 97,363,403 I448N possibly damaging Het
Ttll9 G A 2: 152,983,134 V78M probably damaging Het
Vps13b A G 15: 35,423,155 D207G probably damaging Het
Wdsub1 A G 2: 59,876,665 probably null Het
Zfp799 A G 17: 32,821,035 W85R possibly damaging Het
Zfp839 A T 12: 110,858,769 probably benign Het
Other mutations in Vav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Vav1 APN 17 57299176 missense probably benign 0.21
IGL01613:Vav1 APN 17 57307067 missense possibly damaging 0.93
IGL02032:Vav1 APN 17 57297090 missense possibly damaging 0.91
IGL02213:Vav1 APN 17 57305351 missense possibly damaging 0.84
IGL03009:Vav1 APN 17 57296582 missense probably benign 0.38
Belated UTSW 17 57301214 missense probably benign 0.06
Delayed UTSW 17 57296552 missense probably damaging 1.00
Late UTSW 17 57301870 missense possibly damaging 0.91
Plain_sight UTSW 17 57297122 missense probably damaging 1.00
tardive UTSW 17 57303079 nonsense probably null
R0125:Vav1 UTSW 17 57299847 missense probably damaging 1.00
R0268:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0344:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0579:Vav1 UTSW 17 57279271 missense probably benign 0.01
R0634:Vav1 UTSW 17 57303862 missense probably benign 0.00
R1313:Vav1 UTSW 17 57309498 splice site probably benign
R1345:Vav1 UTSW 17 57301214 missense probably benign 0.06
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1579:Vav1 UTSW 17 57297252 missense probably benign 0.05
R1872:Vav1 UTSW 17 57324750 missense probably damaging 1.00
R1971:Vav1 UTSW 17 57327697 missense probably damaging 1.00
R2197:Vav1 UTSW 17 57303140 missense probably benign 0.37
R2903:Vav1 UTSW 17 57306187 missense probably benign 0.05
R4623:Vav1 UTSW 17 57299839 splice site probably null
R4753:Vav1 UTSW 17 57306140 missense probably damaging 0.98
R4779:Vav1 UTSW 17 57296552 missense probably damaging 1.00
R5232:Vav1 UTSW 17 57303846 missense possibly damaging 0.81
R5240:Vav1 UTSW 17 57297122 missense probably damaging 1.00
R5503:Vav1 UTSW 17 57303079 nonsense probably null
R5592:Vav1 UTSW 17 57304835 missense probably benign 0.00
R5782:Vav1 UTSW 17 57296001 missense probably damaging 1.00
R5945:Vav1 UTSW 17 57301870 missense possibly damaging 0.91
R6113:Vav1 UTSW 17 57301884 missense probably benign 0.00
R6514:Vav1 UTSW 17 57327660 missense probably damaging 1.00
R6575:Vav1 UTSW 17 57305280 missense probably damaging 0.97
R6932:Vav1 UTSW 17 57302330 missense possibly damaging 0.92
R7024:Vav1 UTSW 17 57279268 missense probably damaging 1.00
R7063:Vav1 UTSW 17 57311860 nonsense probably null
R7322:Vav1 UTSW 17 57302266 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCTGATAAGTCCTGTCACCACCC -3'
(R):5'- AGGCAGACCCTCAGGCGCA -3'

Sequencing Primer
(F):5'- agtcttcttctccttgtccatc -3'
(R):5'- TTCCAAAGTCCTGCACATCG -3'
Posted On2013-04-11