Incidental Mutation 'R1864:Ttc22'
ID208470
Institutional Source Beutler Lab
Gene Symbol Ttc22
Ensembl Gene ENSMUSG00000034919
Gene Nametetratricopeptide repeat domain 22
Synonyms
MMRRC Submission 039887-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R1864 (G1)
Quality Score221
Status Not validated
Chromosome4
Chromosomal Location106622432-106640189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106636806 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 321 (V321A)
Ref Sequence ENSEMBL: ENSMUSP00000035773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047922]
Predicted Effect probably benign
Transcript: ENSMUST00000047922
AA Change: V321A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035773
Gene: ENSMUSG00000034919
AA Change: V321A

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
TPR 66 99 2.3e1 SMART
Pfam:TPR_8 100 128 2.5e-3 PFAM
TPR 295 328 2.99e1 SMART
TPR 432 465 6.19e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136505
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with seven tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agtpbp1 A G 13: 59,450,202 Y1198H possibly damaging Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
AI314180 T A 4: 58,849,942 H427L possibly damaging Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ankrd50 A T 3: 38,454,461 N329K probably benign Het
Ano4 C A 10: 88,971,391 G741V probably damaging Het
Anxa1 T C 19: 20,379,689 D191G probably benign Het
Apc2 C T 10: 80,313,648 T1512I probably damaging Het
Aph1b A T 9: 66,794,113 C81S probably benign Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Arhgef28 A T 13: 97,994,132 H399Q probably benign Het
Asic5 A G 3: 82,011,987 E304G probably benign Het
B4galnt4 A G 7: 141,070,533 Y771C probably damaging Het
Birc2 G T 9: 7,819,517 Q465K probably benign Het
Btla C T 16: 45,250,374 T232I probably damaging Het
Ccdc84 A G 9: 44,417,721 C66R probably damaging Het
Ccl7 G T 11: 82,046,552 K37N probably benign Het
Cdk17 T C 10: 93,226,105 V233A probably damaging Het
Cilp2 C A 8: 69,881,323 Q1008H probably damaging Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Clcnka T C 4: 141,392,802 T269A probably damaging Het
Col12a1 A T 9: 79,627,103 probably null Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cyp3a25 T C 5: 145,994,929 D123G probably damaging Het
D630003M21Rik A T 2: 158,203,185 L808Q probably damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx15 T C 5: 52,184,701 T92A possibly damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Diaph2 G A X: 129,960,127 R473Q probably damaging Het
Dnd1 A G 18: 36,766,004 C11R possibly damaging Het
Dock1 A C 7: 135,146,507 D1566A probably benign Het
Drp2 A G X: 134,427,115 I43V probably benign Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Emilin1 A G 5: 30,918,590 E725G probably damaging Het
Eml2 A G 7: 19,201,878 Y487C probably damaging Het
Epg5 T A 18: 77,975,031 L919H probably damaging Het
Fam187a T A 11: 102,886,011 S214T probably damaging Het
Flna T C X: 74,240,263 T521A probably benign Het
Foxi1 T A 11: 34,207,531 I165F probably damaging Het
Fxr2 A T 11: 69,652,277 K633N probably benign Het
Gdpd5 T C 7: 99,448,999 I209T probably benign Het
Gm13212 A T 4: 145,622,428 Q145L possibly damaging Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Grm7 A T 6: 111,080,423 D328V probably benign Het
Heatr6 T C 11: 83,769,230 S534P probably damaging Het
Heph A G X: 96,529,486 T792A probably damaging Het
Hipk2 T A 6: 38,718,935 probably null Het
Hps3 T A 3: 20,019,959 probably null Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Insc T C 7: 114,842,178 I409T probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Kcnma1 T A 14: 23,803,162 Q108L probably damaging Het
Klc3 A G 7: 19,398,041 V137A probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Lgr4 T A 2: 110,011,397 F576I possibly damaging Het
Lypd6b A G 2: 49,947,447 I144V possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Mitf A T 6: 98,010,422 N159I probably damaging Het
Morc1 T C 16: 48,592,530 I678T probably benign Het
Muc4 A G 16: 32,756,251 probably benign Het
Myo7a T C 7: 98,052,256 Y2115C probably damaging Het
Myof T C 19: 37,986,705 I182V probably benign Het
Ncor1 A G 11: 62,381,419 V635A probably damaging Het
Neb G T 2: 52,212,760 Y4257* probably null Het
Npr2 T A 4: 43,641,258 V428E probably benign Het
Nufip2 A G 11: 77,692,298 D346G probably damaging Het
Obsl1 G A 1: 75,493,109 S1088F probably benign Het
Olfr1262 T A 2: 90,002,481 V25E probably benign Het
Olfr1282 C T 2: 111,335,707 V124M possibly damaging Het
Olfr204 A G 16: 59,315,015 Y131H probably damaging Het
Olfr705 T C 7: 106,713,823 N286S possibly damaging Het
Olfr877 T A 9: 37,855,264 Y149N probably damaging Het
Olfr982 T G 9: 40,074,785 I163M possibly damaging Het
Pdgfrb G A 18: 61,071,717 V550I probably benign Het
Pi4ka A T 16: 17,367,525 L237* probably null Het
Pla2r1 G A 2: 60,428,711 T1111M probably benign Het
Plxnd1 A T 6: 115,969,441 probably null Het
Pnp G C 14: 50,947,973 A67P probably benign Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prom2 T C 2: 127,539,787 D203G probably benign Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rnf115 A G 3: 96,727,837 probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rusc2 C A 4: 43,421,719 A713D possibly damaging Het
Ryr3 A T 2: 112,730,328 H3009Q possibly damaging Het
Serpina1d C A 12: 103,767,997 C16F probably benign Het
Serpinf2 G T 11: 75,437,483 R80S possibly damaging Het
Sh2d4a C A 8: 68,329,315 Q192K probably benign Het
Sh3d21 T A 4: 126,150,936 probably null Het
Sh3rf2 T A 18: 42,053,981 L55Q probably damaging Het
Shc4 T C 2: 125,639,367 D255G probably damaging Het
Skint2 T A 4: 112,625,909 H170Q probably benign Het
Slc29a4 A G 5: 142,717,754 Y261C probably damaging Het
Slc35a5 A T 16: 45,143,708 N102K possibly damaging Het
Slc38a3 A T 9: 107,655,953 I307K probably damaging Het
Sv2b A T 7: 75,124,080 S548T probably benign Het
Tgfbi T C 13: 56,632,881 S524P probably benign Het
Tgm5 T C 2: 121,075,218 D152G probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Trpm1 A G 7: 64,268,016 K1258R probably damaging Het
Ube2c C A 2: 164,770,023 A15E probably benign Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Umod A T 7: 119,463,255 L631M probably damaging Het
Ush1c G A 7: 46,219,392 Q373* probably null Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Wnt8b T C 19: 44,493,590 L14P probably benign Het
Wrn G A 8: 33,288,864 A563V probably damaging Het
Zfp608 A G 18: 54,897,911 S986P probably benign Het
Znrf3 T C 11: 5,283,373 H228R possibly damaging Het
Other mutations in Ttc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Ttc22 APN 4 106638576 missense probably damaging 1.00
IGL01749:Ttc22 APN 4 106638603 missense probably benign 0.04
IGL02189:Ttc22 APN 4 106639157 missense probably benign 0.21
IGL02206:Ttc22 APN 4 106635989 missense probably damaging 1.00
IGL02219:Ttc22 APN 4 106638490 missense probably damaging 0.97
IGL02348:Ttc22 APN 4 106622938 missense probably damaging 1.00
IGL02754:Ttc22 APN 4 106638472 missense probably benign 0.22
IGL02982:Ttc22 APN 4 106638586 missense probably damaging 0.97
R0044:Ttc22 UTSW 4 106636806 missense probably benign
R0607:Ttc22 UTSW 4 106639313 missense possibly damaging 0.72
R0611:Ttc22 UTSW 4 106634184 missense probably damaging 1.00
R1148:Ttc22 UTSW 4 106623031 missense probably damaging 1.00
R1148:Ttc22 UTSW 4 106623031 missense probably damaging 1.00
R1466:Ttc22 UTSW 4 106622780 missense probably damaging 1.00
R1466:Ttc22 UTSW 4 106622780 missense probably damaging 1.00
R1584:Ttc22 UTSW 4 106622780 missense probably damaging 1.00
R1654:Ttc22 UTSW 4 106634211 missense probably damaging 1.00
R1776:Ttc22 UTSW 4 106639040 missense possibly damaging 0.64
R1886:Ttc22 UTSW 4 106636866 critical splice donor site probably null
R2136:Ttc22 UTSW 4 106622672 missense possibly damaging 0.49
R2156:Ttc22 UTSW 4 106639040 missense probably benign 0.43
R2267:Ttc22 UTSW 4 106639085 missense possibly damaging 0.60
R2698:Ttc22 UTSW 4 106639238 missense probably benign
R3162:Ttc22 UTSW 4 106623079 missense probably damaging 0.97
R3162:Ttc22 UTSW 4 106623079 missense probably damaging 0.97
R3754:Ttc22 UTSW 4 106639081 missense probably damaging 0.99
R5399:Ttc22 UTSW 4 106636757 missense probably damaging 1.00
R5839:Ttc22 UTSW 4 106638520 missense probably damaging 0.99
R6156:Ttc22 UTSW 4 106638583 missense probably benign 0.00
R6678:Ttc22 UTSW 4 106623045 missense probably benign 0.17
R6912:Ttc22 UTSW 4 106638603 missense probably benign 0.04
R7094:Ttc22 UTSW 4 106635907 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATAGTTGCTGGATGACTGAGC -3'
(R):5'- GCTCAAAGCATTGTCAGGGG -3'

Sequencing Primer
(F):5'- ATGCTGGCCGTGGGTAC -3'
(R):5'- GCCGAGATGGTTCCCAAGTTC -3'
Posted On2014-06-30