Incidental Mutation 'R0116:Mus81'
ID20852
Institutional Source Beutler Lab
Gene Symbol Mus81
Ensembl Gene ENSMUSG00000024906
Gene NameMUS81 structure-specific endonuclease subunit
Synonyms
MMRRC Submission 038402-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R0116 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location5482345-5488402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5486524 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 138 (A138D)
Ref Sequence ENSEMBL: ENSMUSP00000114895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025841] [ENSMUST00000070118] [ENSMUST00000116560] [ENSMUST00000124334] [ENSMUST00000126471] [ENSMUST00000165485] [ENSMUST00000167371] [ENSMUST00000168330] [ENSMUST00000209469]
PDB Structure
Solution NMR structure of the Mus81 N-terminal HhH. Northeast Structural Genomics Consortium target MmT1A [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000025841
AA Change: A138D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025841
Gene: ENSMUSG00000024906
AA Change: A138D

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 7e-3 SMART
PDB:2KP7|A 11 90 5e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 1e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070118
SMART Domains Protein: ENSMUSP00000064719
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
EGF_like 73 113 2.74e-1 SMART
low complexity region 115 130 N/A INTRINSIC
EGF_CA 142 182 1.08e-10 SMART
EGF_CA 183 221 1.94e-12 SMART
EGF_CA 222 261 1.36e-7 SMART
EGF_CA 262 301 2.19e-11 SMART
EGF 305 347 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116560
SMART Domains Protein: ENSMUSP00000112259
Gene: ENSMUSG00000056201

DomainStartEndE-ValueType
ADF 19 154 5.3e-56 SMART
low complexity region 195 205 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124334
AA Change: A138D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114895
Gene: ENSMUSG00000024906
AA Change: A138D

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 9e-3 SMART
PDB:2KP7|A 11 90 9e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 3e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126471
SMART Domains Protein: ENSMUSP00000121435
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
PDB:2KP7|A 11 72 8e-21 PDB
Predicted Effect unknown
Transcript: ENSMUST00000133436
AA Change: A102D
SMART Domains Protein: ENSMUSP00000118580
Gene: ENSMUSG00000024906
AA Change: A102D

DomainStartEndE-ValueType
PDB:2KP7|A 2 55 5e-30 PDB
low complexity region 57 72 N/A INTRINSIC
PDB:2MC3|A 86 194 8e-50 PDB
ERCC4 235 337 8.31e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154215
Predicted Effect probably benign
Transcript: ENSMUST00000164204
SMART Domains Protein: ENSMUSP00000128414
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Pfam:EGF_CA 37 69 5.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165485
SMART Domains Protein: ENSMUSP00000133016
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 163 1.08e-10 SMART
EGF_CA 164 202 1.94e-12 SMART
EGF_CA 203 242 1.36e-7 SMART
EGF_CA 243 282 2.19e-11 SMART
EGF 286 328 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167371
SMART Domains Protein: ENSMUSP00000129746
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 161 1.94e-12 SMART
EGF_CA 162 201 1.36e-7 SMART
EGF_CA 202 241 2.19e-11 SMART
EGF 245 287 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168330
Predicted Effect probably benign
Transcript: ENSMUST00000209469
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 94% (95/101)
MGI Phenotype PHENOTYPE: Homozygous and heterozygous null mice for one allele display increased tumor incidence and reduced life spans. Homozygous null mice for a second allele display normal life span and tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,290,770 V152E probably damaging Het
Abca5 T G 11: 110,276,505 E1495A probably damaging Het
Abcc12 G A 8: 86,534,998 S668F probably benign Het
Adgrl4 A T 3: 151,517,610 T608S probably benign Het
Angel2 G A 1: 190,940,990 D255N probably benign Het
Apob T A 12: 7,989,113 probably benign Het
Arfgef2 A T 2: 166,873,683 R1349S probably damaging Het
Atp2b2 C T 6: 113,793,695 V418I probably damaging Het
Birc6 C A 17: 74,623,746 probably benign Het
Capn13 T A 17: 73,351,524 Y183F probably damaging Het
Cngb1 A G 8: 95,260,638 S352P probably damaging Het
Col6a3 A G 1: 90,813,551 S720P probably damaging Het
Cpa4 C T 6: 30,579,658 R155W probably damaging Het
Dapk1 A G 13: 60,761,100 I1176V probably benign Het
Dnah17 T C 11: 118,058,306 E2959G probably benign Het
Dnah7b T A 1: 46,213,360 I1734N possibly damaging Het
Dnajb7 A G 15: 81,407,354 Y261H probably benign Het
Dock2 T C 11: 34,688,565 probably benign Het
Dusp27 A C 1: 166,099,701 S781A probably benign Het
Dyrk3 A T 1: 131,129,839 V199E probably damaging Het
F2r G T 13: 95,604,486 C180* probably null Het
F5 A G 1: 164,184,914 S466G probably benign Het
Fbn2 A T 18: 58,102,373 C677* probably null Het
Fbxo41 A G 6: 85,477,908 S673P probably damaging Het
Fhad1 G T 4: 141,940,095 H639N probably benign Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Foxa2 A G 2: 148,043,561 S270P probably damaging Het
Fxyd7 C T 7: 31,047,368 probably null Het
Gm5225 A G 17: 24,024,058 D67G probably benign Het
Grik3 G A 4: 125,670,556 E444K probably benign Het
Gsdma2 A G 11: 98,649,183 K44E probably damaging Het
Haus1 T A 18: 77,762,070 K130* probably null Het
Heg1 A G 16: 33,735,658 probably benign Het
Hormad2 A G 11: 4,412,206 probably benign Het
Hsd17b3 G A 13: 64,058,589 R300C possibly damaging Het
Irf5 T C 6: 29,536,109 F374S probably damaging Het
Itch A G 2: 155,217,983 probably benign Het
Jade2 A T 11: 51,831,309 L139Q probably damaging Het
Kif5c G A 2: 49,752,239 probably benign Het
Lama1 T C 17: 67,776,923 Y1387H probably benign Het
Larp4b A G 13: 9,170,688 R658G probably damaging Het
Mcph1 C T 8: 18,788,248 L729F probably benign Het
Me1 A T 9: 86,654,667 N118K probably benign Het
Med13 A G 11: 86,319,897 L473S probably damaging Het
Mgam T A 6: 40,658,987 Y359N probably damaging Het
Morc2b A G 17: 33,137,041 S586P probably damaging Het
Mthfr A G 4: 148,051,523 D310G probably benign Het
Mtmr7 A T 8: 40,581,405 probably benign Het
Mtus1 A G 8: 40,998,477 probably benign Het
Myom2 A T 8: 15,117,633 I1073F probably damaging Het
Nhsl1 A T 10: 18,525,242 K739* probably null Het
Nlrp4d T A 7: 10,374,891 K762N probably benign Het
Nrap T C 19: 56,355,546 Y724C probably damaging Het
Ogn A T 13: 49,621,038 Y219F possibly damaging Het
Olfr805 T A 10: 129,722,977 D189V probably damaging Het
Olfr923 T C 9: 38,828,564 L291P probably damaging Het
Olfr948 A T 9: 39,318,864 I250N probably damaging Het
Padi2 T C 4: 140,926,239 V180A probably benign Het
Papss2 C T 19: 32,638,368 R167* probably null Het
Pcbp2 T C 15: 102,474,235 probably benign Het
Per1 T A 11: 69,101,880 probably benign Het
Pik3ca T C 3: 32,459,945 I860T probably damaging Het
Pkdrej G A 15: 85,817,545 Q1397* probably null Het
Plce1 T C 19: 38,721,821 V1133A probably benign Het
Pnmal1 T G 7: 16,960,700 V160G probably damaging Het
Prss12 T C 3: 123,482,774 C351R probably damaging Het
Qprt A T 7: 127,109,097 L54Q probably damaging Het
Raf1 C T 6: 115,626,383 S165N probably damaging Het
Rere A G 4: 150,616,976 N1271S probably benign Het
Rnasel T A 1: 153,754,512 L258H probably damaging Het
Ryr2 T C 13: 11,709,921 D2502G probably damaging Het
Ryr3 G A 2: 112,803,165 S2081L probably damaging Het
Sc5d G T 9: 42,259,859 Y11* probably null Het
Slc25a29 A C 12: 108,827,091 L187R possibly damaging Het
Slc2a7 G A 4: 150,168,264 V454M probably benign Het
Slco1b2 A T 6: 141,669,388 T340S probably benign Het
Smarcc1 A G 9: 110,147,104 N153S possibly damaging Het
Snx1 C A 9: 66,088,539 E516* probably null Het
Sptlc2 T C 12: 87,356,680 D115G probably benign Het
Stard9 A G 2: 120,634,255 N67S probably damaging Het
Swap70 G A 7: 110,273,282 R368H probably benign Het
Tcaf3 T C 6: 42,591,350 K691E probably benign Het
Tmco4 T C 4: 139,053,920 F465S probably damaging Het
Tmem245 A G 4: 56,926,213 S290P probably benign Het
Top2a T C 11: 99,003,590 T972A probably benign Het
Tpr T A 1: 150,410,147 S527R probably damaging Het
Traf2 T C 2: 25,519,609 D443G probably damaging Het
Trim40 A T 17: 36,883,147 probably null Het
Trim42 A T 9: 97,363,403 I448N possibly damaging Het
Ttll9 G A 2: 152,983,134 V78M probably damaging Het
Vav1 C T 17: 57,296,039 L88F probably damaging Het
Vps13b A G 15: 35,423,155 D207G probably damaging Het
Wdsub1 A G 2: 59,876,665 probably null Het
Zfp799 A G 17: 32,821,035 W85R possibly damaging Het
Zfp839 A T 12: 110,858,769 probably benign Het
Other mutations in Mus81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02120:Mus81 APN 19 5485633 unclassified probably benign
IGL03140:Mus81 APN 19 5483956 missense probably damaging 1.00
IGL03370:Mus81 APN 19 5484963 unclassified probably benign
R0480:Mus81 UTSW 19 5487931 unclassified probably benign
R1243:Mus81 UTSW 19 5485117 missense probably benign
R1439:Mus81 UTSW 19 5485117 missense probably benign
R1477:Mus81 UTSW 19 5486334 missense probably benign 0.00
R1795:Mus81 UTSW 19 5483476 missense probably benign 0.00
R2346:Mus81 UTSW 19 5484963 unclassified probably benign
R2863:Mus81 UTSW 19 5486500 missense probably damaging 1.00
R3785:Mus81 UTSW 19 5485361 unclassified probably benign
R5312:Mus81 UTSW 19 5483494 missense possibly damaging 0.79
R5489:Mus81 UTSW 19 5487889 unclassified probably benign
R6037:Mus81 UTSW 19 5484004 missense probably damaging 1.00
R6037:Mus81 UTSW 19 5484004 missense probably damaging 1.00
R6970:Mus81 UTSW 19 5485526 missense probably benign 0.45
R7037:Mus81 UTSW 19 5486080 missense probably damaging 1.00
R7060:Mus81 UTSW 19 5487793 missense probably benign 0.30
R7100:Mus81 UTSW 19 5484211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCACTCTCAGAAGATGCTCAC -3'
(R):5'- ACTAGGGCTTGTAGCCTCATCTCC -3'

Sequencing Primer
(F):5'- CAGAAGATGCTCACCCTGG -3'
(R):5'- TCATCTCCCTCGCCAGG -3'
Posted On2013-04-11