Incidental Mutation 'R1864:Kcnma1'
ID208548
Institutional Source Beutler Lab
Gene Symbol Kcnma1
Ensembl Gene ENSMUSG00000063142
Gene Namepotassium large conductance calcium-activated channel, subfamily M, alpha member 1
SynonymsmSlo1, MaxiK, Slo1, 5730414M22Rik, BK channel alpha subunit, BKCa, Slo
MMRRC Submission 039887-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R1864 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location23289431-24014491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23803162 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 108 (Q108L)
Ref Sequence ENSEMBL: ENSMUSP00000152959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065788] [ENSMUST00000074983] [ENSMUST00000100831] [ENSMUST00000145596] [ENSMUST00000163322] [ENSMUST00000172099] [ENSMUST00000177634] [ENSMUST00000179097] [ENSMUST00000179836] [ENSMUST00000188210] [ENSMUST00000188285] [ENSMUST00000188991] [ENSMUST00000190044] [ENSMUST00000190985] [ENSMUST00000223655] [ENSMUST00000223727] [ENSMUST00000223749] [ENSMUST00000224077] [ENSMUST00000224232] [ENSMUST00000224285] [ENSMUST00000224468] [ENSMUST00000224787] [ENSMUST00000224812] [ENSMUST00000225315] [ENSMUST00000225431] [ENSMUST00000225471] [ENSMUST00000225556] [ENSMUST00000225794] [ENSMUST00000226051]
Predicted Effect probably damaging
Transcript: ENSMUST00000065788
AA Change: Q48L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065293
Gene: ENSMUSG00000063142
AA Change: Q48L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 835 843 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 1005 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074983
AA Change: Q48L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074511
Gene: ENSMUSG00000063142
AA Change: Q48L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 894 902 N/A INTRINSIC
low complexity region 950 961 N/A INTRINSIC
low complexity region 1064 1090 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100831
AA Change: Q48L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098393
Gene: ENSMUSG00000063142
AA Change: Q48L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.1e-18 PFAM
Pfam:Ion_trans_2 180 268 5.5e-16 PFAM
Pfam:TrkA_N 314 413 7.3e-7 PFAM
Pfam:BK_channel_a 411 509 6.2e-31 PFAM
low complexity region 865 873 N/A INTRINSIC
low complexity region 921 932 N/A INTRINSIC
low complexity region 1035 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145596
AA Change: Q173L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000163322
AA Change: Q48L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128553
Gene: ENSMUSG00000063142
AA Change: Q48L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 3.2e-18 PFAM
Pfam:Ion_trans_2 180 268 1.1e-15 PFAM
Pfam:TrkA_N 314 413 7e-7 PFAM
Pfam:BK_channel_a 411 509 6e-31 PFAM
low complexity region 832 840 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 1002 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172099
AA Change: Q48L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132204
Gene: ENSMUSG00000063142
AA Change: Q48L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.6e-7 PFAM
Pfam:BK_channel_a 411 509 6.5e-31 PFAM
low complexity region 897 905 N/A INTRINSIC
low complexity region 953 964 N/A INTRINSIC
low complexity region 1067 1093 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177634
AA Change: Q48L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136447
Gene: ENSMUSG00000063142
AA Change: Q48L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
Pfam:Ion_trans 53 272 4.9e-19 PFAM
Pfam:Ion_trans_2 180 267 1.2e-15 PFAM
Pfam:BK_channel_a 413 508 1.2e-35 PFAM
low complexity region 862 870 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1032 1058 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179097
AA Change: Q48L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136568
Gene: ENSMUSG00000063142
AA Change: Q48L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.6e-18 PFAM
Pfam:Ion_trans_2 180 268 1e-15 PFAM
Pfam:TrkA_N 314 413 1.1e-7 PFAM
Pfam:BK_channel_a 411 509 3.2e-31 PFAM
low complexity region 859 867 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1029 1055 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179836
AA Change: Q48L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137141
Gene: ENSMUSG00000063142
AA Change: Q48L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.2e-18 PFAM
Pfam:Ion_trans_2 180 268 9.5e-16 PFAM
Pfam:BK_channel_a 389 457 2.4e-15 PFAM
low complexity region 838 846 N/A INTRINSIC
low complexity region 894 905 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188210
AA Change: Q108L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142
AA Change: Q108L

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.2e-16 PFAM
Pfam:TrkA_N 439 538 7.8e-7 PFAM
Pfam:BK_channel_a 536 634 5e-31 PFAM
low complexity region 988 996 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
low complexity region 1158 1184 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188285
AA Change: Q173L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142
AA Change: Q173L

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.4e-16 PFAM
Pfam:TrkA_N 439 538 8e-7 PFAM
Pfam:BK_channel_a 536 634 5.2e-31 PFAM
low complexity region 1019 1027 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1189 1215 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188991
AA Change: Q173L

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142
AA Change: Q173L

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 3.3e-18 PFAM
Pfam:Ion_trans_2 305 393 1.1e-15 PFAM
Pfam:TrkA_N 439 538 3.7e-7 PFAM
Pfam:BK_channel_a 536 634 3.4e-31 PFAM
low complexity region 1015 1023 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1185 1211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190044
AA Change: Q173L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142
AA Change: Q173L

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.1e-16 PFAM
Pfam:TrkA_N 439 538 7.5e-7 PFAM
Pfam:BK_channel_a 536 634 4.9e-31 PFAM
low complexity region 957 965 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1127 1153 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000190985
AA Change: Q108L
Predicted Effect probably damaging
Transcript: ENSMUST00000223655
AA Change: Q108L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223727
AA Change: Q108L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000223749
AA Change: Q108L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000224025
AA Change: Q123L
Predicted Effect probably damaging
Transcript: ENSMUST00000224077
AA Change: Q108L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224232
AA Change: Q108L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000224285
AA Change: Q108L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000224468
AA Change: Q173L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000224787
Predicted Effect probably damaging
Transcript: ENSMUST00000224812
AA Change: Q108L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000225315
AA Change: Q108L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000225431
AA Change: Q108L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000225471
AA Change: Q108L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000225556
AA Change: Q108L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225794
AA Change: Q108L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226051
AA Change: Q15L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agtpbp1 A G 13: 59,450,202 Y1198H possibly damaging Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
AI314180 T A 4: 58,849,942 H427L possibly damaging Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ankrd50 A T 3: 38,454,461 N329K probably benign Het
Ano4 C A 10: 88,971,391 G741V probably damaging Het
Anxa1 T C 19: 20,379,689 D191G probably benign Het
Apc2 C T 10: 80,313,648 T1512I probably damaging Het
Aph1b A T 9: 66,794,113 C81S probably benign Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Arhgef28 A T 13: 97,994,132 H399Q probably benign Het
Asic5 A G 3: 82,011,987 E304G probably benign Het
B4galnt4 A G 7: 141,070,533 Y771C probably damaging Het
Birc2 G T 9: 7,819,517 Q465K probably benign Het
Btla C T 16: 45,250,374 T232I probably damaging Het
Ccdc84 A G 9: 44,417,721 C66R probably damaging Het
Ccl7 G T 11: 82,046,552 K37N probably benign Het
Cdk17 T C 10: 93,226,105 V233A probably damaging Het
Cilp2 C A 8: 69,881,323 Q1008H probably damaging Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Clcnka T C 4: 141,392,802 T269A probably damaging Het
Col12a1 A T 9: 79,627,103 probably null Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cyp3a25 T C 5: 145,994,929 D123G probably damaging Het
D630003M21Rik A T 2: 158,203,185 L808Q probably damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx15 T C 5: 52,184,701 T92A possibly damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Diaph2 G A X: 129,960,127 R473Q probably damaging Het
Dnd1 A G 18: 36,766,004 C11R possibly damaging Het
Dock1 A C 7: 135,146,507 D1566A probably benign Het
Drp2 A G X: 134,427,115 I43V probably benign Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Emilin1 A G 5: 30,918,590 E725G probably damaging Het
Eml2 A G 7: 19,201,878 Y487C probably damaging Het
Epg5 T A 18: 77,975,031 L919H probably damaging Het
Fam187a T A 11: 102,886,011 S214T probably damaging Het
Flna T C X: 74,240,263 T521A probably benign Het
Foxi1 T A 11: 34,207,531 I165F probably damaging Het
Fxr2 A T 11: 69,652,277 K633N probably benign Het
Gdpd5 T C 7: 99,448,999 I209T probably benign Het
Gm13212 A T 4: 145,622,428 Q145L possibly damaging Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Grm7 A T 6: 111,080,423 D328V probably benign Het
Heatr6 T C 11: 83,769,230 S534P probably damaging Het
Heph A G X: 96,529,486 T792A probably damaging Het
Hipk2 T A 6: 38,718,935 probably null Het
Hps3 T A 3: 20,019,959 probably null Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Insc T C 7: 114,842,178 I409T probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Klc3 A G 7: 19,398,041 V137A probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Lgr4 T A 2: 110,011,397 F576I possibly damaging Het
Lypd6b A G 2: 49,947,447 I144V possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Mitf A T 6: 98,010,422 N159I probably damaging Het
Morc1 T C 16: 48,592,530 I678T probably benign Het
Muc4 A G 16: 32,756,251 probably benign Het
Myo7a T C 7: 98,052,256 Y2115C probably damaging Het
Myof T C 19: 37,986,705 I182V probably benign Het
Ncor1 A G 11: 62,381,419 V635A probably damaging Het
Neb G T 2: 52,212,760 Y4257* probably null Het
Npr2 T A 4: 43,641,258 V428E probably benign Het
Nufip2 A G 11: 77,692,298 D346G probably damaging Het
Obsl1 G A 1: 75,493,109 S1088F probably benign Het
Olfr1262 T A 2: 90,002,481 V25E probably benign Het
Olfr1282 C T 2: 111,335,707 V124M possibly damaging Het
Olfr204 A G 16: 59,315,015 Y131H probably damaging Het
Olfr705 T C 7: 106,713,823 N286S possibly damaging Het
Olfr877 T A 9: 37,855,264 Y149N probably damaging Het
Olfr982 T G 9: 40,074,785 I163M possibly damaging Het
Pdgfrb G A 18: 61,071,717 V550I probably benign Het
Pi4ka A T 16: 17,367,525 L237* probably null Het
Pla2r1 G A 2: 60,428,711 T1111M probably benign Het
Plxnd1 A T 6: 115,969,441 probably null Het
Pnp G C 14: 50,947,973 A67P probably benign Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prom2 T C 2: 127,539,787 D203G probably benign Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rnf115 A G 3: 96,727,837 probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rusc2 C A 4: 43,421,719 A713D possibly damaging Het
Ryr3 A T 2: 112,730,328 H3009Q possibly damaging Het
Serpina1d C A 12: 103,767,997 C16F probably benign Het
Serpinf2 G T 11: 75,437,483 R80S possibly damaging Het
Sh2d4a C A 8: 68,329,315 Q192K probably benign Het
Sh3d21 T A 4: 126,150,936 probably null Het
Sh3rf2 T A 18: 42,053,981 L55Q probably damaging Het
Shc4 T C 2: 125,639,367 D255G probably damaging Het
Skint2 T A 4: 112,625,909 H170Q probably benign Het
Slc29a4 A G 5: 142,717,754 Y261C probably damaging Het
Slc35a5 A T 16: 45,143,708 N102K possibly damaging Het
Slc38a3 A T 9: 107,655,953 I307K probably damaging Het
Sv2b A T 7: 75,124,080 S548T probably benign Het
Tgfbi T C 13: 56,632,881 S524P probably benign Het
Tgm5 T C 2: 121,075,218 D152G probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Trpm1 A G 7: 64,268,016 K1258R probably damaging Het
Ttc22 T C 4: 106,636,806 V321A probably benign Het
Ube2c C A 2: 164,770,023 A15E probably benign Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Umod A T 7: 119,463,255 L631M probably damaging Het
Ush1c G A 7: 46,219,392 Q373* probably null Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Wnt8b T C 19: 44,493,590 L14P probably benign Het
Wrn G A 8: 33,288,864 A563V probably damaging Het
Zfp608 A G 18: 54,897,911 S986P probably benign Het
Znrf3 T C 11: 5,283,373 H228R possibly damaging Het
Other mutations in Kcnma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kcnma1 APN 14 23314322 splice site probably benign
IGL01520:Kcnma1 APN 14 23501143 missense possibly damaging 0.94
IGL01977:Kcnma1 APN 14 23530299 splice site probably benign
IGL02140:Kcnma1 APN 14 23309045 missense probably damaging 1.00
IGL02165:Kcnma1 APN 14 23336967 missense possibly damaging 0.93
IGL02186:Kcnma1 APN 14 23526813 missense probably benign 0.28
IGL02268:Kcnma1 APN 14 23543076 missense probably damaging 1.00
IGL02353:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02360:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02491:Kcnma1 APN 14 23311689 missense probably damaging 1.00
IGL02552:Kcnma1 APN 14 23386259 critical splice donor site probably null
IGL02625:Kcnma1 APN 14 23363832 missense probably damaging 1.00
IGL02677:Kcnma1 APN 14 23463156 missense probably damaging 1.00
IGL02706:Kcnma1 APN 14 23309154 missense probably damaging 1.00
PIT4495001:Kcnma1 UTSW 14 23425597 missense probably benign 0.00
PIT4514001:Kcnma1 UTSW 14 23309035 splice site probably null
PIT4576001:Kcnma1 UTSW 14 23309035 splice site probably null
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0115:Kcnma1 UTSW 14 23314175 missense probably damaging 1.00
R0172:Kcnma1 UTSW 14 23803166 missense probably damaging 1.00
R0178:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0183:Kcnma1 UTSW 14 23508052 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0328:Kcnma1 UTSW 14 23373197 missense probably damaging 1.00
R0501:Kcnma1 UTSW 14 23311716 missense possibly damaging 0.80
R0631:Kcnma1 UTSW 14 23509784 splice site probably benign
R0668:Kcnma1 UTSW 14 23367495 missense probably damaging 1.00
R0811:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R0812:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R1080:Kcnma1 UTSW 14 23494607 missense probably damaging 1.00
R1419:Kcnma1 UTSW 14 23367642 missense probably damaging 0.99
R1446:Kcnma1 UTSW 14 23311724 missense probably damaging 1.00
R1454:Kcnma1 UTSW 14 23463200 missense probably damaging 1.00
R1651:Kcnma1 UTSW 14 23314194 missense probably damaging 1.00
R1826:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1827:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1828:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R2002:Kcnma1 UTSW 14 23337029 missense probably damaging 0.99
R2140:Kcnma1 UTSW 14 23314220 missense probably damaging 1.00
R2278:Kcnma1 UTSW 14 23543083 nonsense probably null
R2866:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2900:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R3820:Kcnma1 UTSW 14 23299938 missense possibly damaging 0.66
R3821:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R3901:Kcnma1 UTSW 14 23505255 missense probably damaging 0.98
R3975:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R3976:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R4352:Kcnma1 UTSW 14 23311652 missense probably damaging 1.00
R4517:Kcnma1 UTSW 14 23337029 missense probably damaging 1.00
R4598:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R4604:Kcnma1 UTSW 14 23309038 critical splice donor site probably null
R4743:Kcnma1 UTSW 14 23803202 missense probably damaging 1.00
R4754:Kcnma1 UTSW 14 23363836 missense probably damaging 0.96
R4908:Kcnma1 UTSW 14 23309152 missense probably damaging 0.99
R4960:Kcnma1 UTSW 14 24004118 intron probably benign
R5175:Kcnma1 UTSW 14 23336038 critical splice donor site probably null
R5218:Kcnma1 UTSW 14 23463185 missense probably damaging 0.96
R5435:Kcnma1 UTSW 14 23528404 nonsense probably null
R5705:Kcnma1 UTSW 14 24003771 missense possibly damaging 0.73
R5746:Kcnma1 UTSW 14 23494567 missense probably damaging 1.00
R5780:Kcnma1 UTSW 14 23386351 nonsense probably null
R5793:Kcnma1 UTSW 14 23309035 splice site probably null
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6133:Kcnma1 UTSW 14 24003868 missense probably damaging 0.98
R6271:Kcnma1 UTSW 14 23509889 missense probably damaging 1.00
R6490:Kcnma1 UTSW 14 23336097 missense possibly damaging 0.46
R6704:Kcnma1 UTSW 14 24002814 nonsense probably null
R6822:Kcnma1 UTSW 14 24003744 splice site probably null
R6855:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R6920:Kcnma1 UTSW 14 23526534 critical splice donor site probably null
R7017:Kcnma1 UTSW 14 23494643 missense possibly damaging 0.79
R7081:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R7113:Kcnma1 UTSW 14 23463156 missense probably damaging 1.00
R7131:Kcnma1 UTSW 14 23367494 missense probably damaging 1.00
R7172:Kcnma1 UTSW 14 23526623 missense probably damaging 1.00
R7207:Kcnma1 UTSW 14 23309015 makesense probably null
R7308:Kcnma1 UTSW 14 23330935 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCCTACTGTCTGCAGATG -3'
(R):5'- GGGTAAGGATCTGATTTAAATCCAGC -3'

Sequencing Primer
(F):5'- CCTACACTGCAGGCTTAGATATGTG -3'
(R):5'- GGATCTGATTTAAATCCAGCTGTTTC -3'
Posted On2014-06-30