Incidental Mutation 'R0117:Postn'
ID20866
Institutional Source Beutler Lab
Gene Symbol Postn
Ensembl Gene ENSMUSG00000027750
Gene Nameperiostin, osteoblast specific factor
Synonymsperi, A630052E07Rik, OSF-2, Osf2, Periostin
MMRRC Submission 038403-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0117 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54361109-54391037 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 54383481 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000073012] [ENSMUST00000081564] [ENSMUST00000107985] [ENSMUST00000117373]
Predicted Effect probably benign
Transcript: ENSMUST00000073012
SMART Domains Protein: ENSMUSP00000072773
Gene: ENSMUSG00000027750

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081564
SMART Domains Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107985
SMART Domains Protein: ENSMUSP00000103619
Gene: ENSMUSG00000027750

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117373
SMART Domains Protein: ENSMUSP00000112735
Gene: ENSMUSG00000027750

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127452
Predicted Effect probably benign
Transcript: ENSMUST00000143258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154157
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display abnormalities of the enamel, periodontal ligament, ameloblasts, and incisors. For one allele changing the hardness of the food alters the severity of the abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Postn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Postn APN 3 54373728 missense probably damaging 1.00
IGL00567:Postn APN 3 54384523 missense probably benign
IGL00742:Postn APN 3 54372894 missense possibly damaging 0.81
IGL00971:Postn APN 3 54369276 missense possibly damaging 0.88
IGL01105:Postn APN 3 54362710 missense probably damaging 1.00
IGL01460:Postn APN 3 54375158 unclassified probably benign
IGL01609:Postn APN 3 54369228 missense probably damaging 0.99
IGL01878:Postn APN 3 54383480 splice site probably null
IGL01885:Postn APN 3 54376034 unclassified probably benign
IGL02040:Postn APN 3 54362689 missense probably benign
IGL02431:Postn APN 3 54375096 missense probably damaging 0.99
IGL02578:Postn APN 3 54377204 missense possibly damaging 0.93
IGL02943:Postn APN 3 54377608 critical splice donor site probably null
IGL03307:Postn APN 3 54375127 missense probably benign 0.32
sticklike UTSW 3 54372106 missense probably damaging 1.00
R0270:Postn UTSW 3 54384550 missense probably damaging 0.98
R0410:Postn UTSW 3 54385277 missense possibly damaging 0.93
R0548:Postn UTSW 3 54367576 nonsense probably null
R0734:Postn UTSW 3 54362715 missense probably damaging 1.00
R1648:Postn UTSW 3 54376101 missense probably damaging 1.00
R1796:Postn UTSW 3 54373756 missense probably damaging 1.00
R1823:Postn UTSW 3 54385287 critical splice donor site probably null
R1938:Postn UTSW 3 54377612 splice site probably null
R2311:Postn UTSW 3 54385223 missense probably damaging 0.98
R2566:Postn UTSW 3 54376953 missense probably damaging 0.97
R2938:Postn UTSW 3 54370310 missense probably damaging 1.00
R4105:Postn UTSW 3 54376041 missense probably damaging 1.00
R4394:Postn UTSW 3 54370955 missense probably damaging 1.00
R4620:Postn UTSW 3 54376993 missense probably damaging 1.00
R4628:Postn UTSW 3 54372157 missense probably damaging 1.00
R4697:Postn UTSW 3 54375071 missense probably damaging 1.00
R4709:Postn UTSW 3 54384610 intron probably benign
R4952:Postn UTSW 3 54390315 utr 3 prime probably benign
R5303:Postn UTSW 3 54377597 missense probably damaging 1.00
R5704:Postn UTSW 3 54372106 missense probably damaging 1.00
R5902:Postn UTSW 3 54372089 missense probably benign 0.03
R5914:Postn UTSW 3 54373800 nonsense probably null
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6101:Postn UTSW 3 54372220 splice site probably null
R6105:Postn UTSW 3 54372220 splice site probably null
R6334:Postn UTSW 3 54385282 missense probably benign
R7131:Postn UTSW 3 54362635 missense probably damaging 1.00
R7322:Postn UTSW 3 54370280 missense probably damaging 1.00
R7430:Postn UTSW 3 54370202 missense probably damaging 1.00
R7497:Postn UTSW 3 54362670 missense not run
X0004:Postn UTSW 3 54362694 missense probably damaging 1.00
X0022:Postn UTSW 3 54370840 missense probably benign 0.03
Z1088:Postn UTSW 3 54375127 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGCTCGTGCATCACTGTAAATGCTAA -3'
(R):5'- CCATCAACCCCTTCTCTTCTGAGAACAA -3'

Sequencing Primer
(F):5'- CATCACTGTAAATGCTAAAGTGGG -3'
(R):5'- AAGTGATCCAGGAGCTTAATCC -3'
Posted On2013-04-11