Incidental Mutation 'R1866:Olfr1047'
ID208692
Institutional Source Beutler Lab
Gene Symbol Olfr1047
Ensembl Gene ENSMUSG00000075196
Gene Nameolfactory receptor 1047
SynonymsMOR188-3, GA_x6K02T2Q125-47703682-47702723
MMRRC Submission 039889-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R1866 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86226567-86231401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86228728 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 81 (M81R)
Ref Sequence ENSEMBL: ENSMUSP00000150247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099901] [ENSMUST00000216056]
Predicted Effect probably damaging
Transcript: ENSMUST00000099901
AA Change: M81R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097485
Gene: ENSMUSG00000075196
AA Change: M81R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5e-51 PFAM
Pfam:7tm_1 41 290 4.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216056
AA Change: M81R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 A T 19: 23,892,831 E9V probably benign Het
Armc8 T A 9: 99,536,280 T32S probably benign Het
Atr T A 9: 95,870,605 probably null Het
Blm A G 7: 80,494,114 L859P probably benign Het
Cacna2d3 A T 14: 28,969,214 F51L probably damaging Het
Cdcp2 A G 4: 107,107,000 N349S probably damaging Het
Cfap57 G A 4: 118,599,927 H442Y possibly damaging Het
Chrm3 A G 13: 9,878,481 L173P probably damaging Het
Cpb1 C G 3: 20,263,756 M201I probably benign Het
Dgcr8 A T 16: 18,258,314 N2K probably damaging Het
Dnah3 A T 7: 119,928,856 probably null Het
Dnah6 T A 6: 73,100,088 Q2398L probably benign Het
Dpep2 A T 8: 105,989,448 probably null Het
E430018J23Rik A G 7: 127,393,331 W36R probably damaging Het
Eif2ak4 C A 2: 118,472,661 T1504K probably damaging Het
Exoc6b A G 6: 84,851,914 V496A probably damaging Het
Fam174a A C 1: 95,313,895 S27R probably benign Het
Fat2 T A 11: 55,292,014 Q1339L probably benign Het
Fkbpl T A 17: 34,645,823 D188E possibly damaging Het
Focad A G 4: 88,407,165 D89G possibly damaging Het
Fstl4 C A 11: 53,186,398 Q661K probably benign Het
Gck T C 11: 5,903,253 Y289C probably benign Het
Gm156 A G 6: 129,775,380 probably null Het
Gm16181 T A 17: 35,223,937 probably benign Het
Herc1 G A 9: 66,450,791 G2385S probably damaging Het
Igfn1 T C 1: 135,974,868 probably null Het
Il12b T C 11: 44,408,526 W141R probably damaging Het
Itga6 T A 2: 71,834,070 S517T probably benign Het
Kank1 A G 19: 25,411,449 S801G probably benign Het
Lctl A G 9: 64,131,721 D205G probably damaging Het
Lhx3 A C 2: 26,203,974 V79G probably damaging Het
Lrrc9 T C 12: 72,497,138 I1127T probably damaging Het
Ltbp3 A T 19: 5,747,849 E505D probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map6 A G 7: 99,315,876 S291G probably damaging Het
Mapk7 A G 11: 61,489,413 F671L probably benign Het
Mau2 A G 8: 70,031,492 W149R probably damaging Het
Mb21d2 C T 16: 28,828,515 V236I possibly damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Mical1 C A 10: 41,485,470 P797Q probably benign Het
Mnx1 G A 5: 29,474,045 R347C unknown Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nlrp2 G T 7: 5,327,716 C560* probably null Het
Npat T A 9: 53,563,116 L736H probably damaging Het
Nup155 T A 15: 8,115,526 V147E probably damaging Het
Nxpe2 A G 9: 48,326,821 F45L probably benign Het
Obscn T C 11: 59,060,915 D4370G probably benign Het
Olfr1000 T A 2: 85,608,844 H22L probably benign Het
Olfr1252 T C 2: 89,721,206 K302E probably benign Het
Olfr1260 T C 2: 89,978,327 L183S probably damaging Het
Olfr1425 A G 19: 12,073,819 V271A probably benign Het
Olfr1532-ps1 A G 7: 106,915,066 I289M probably damaging Het
Olfr658 A G 7: 104,644,797 S190P probably benign Het
Pcx T C 19: 4,621,221 I1157T possibly damaging Het
Pias2 T A 18: 77,152,716 S589R probably benign Het
Plcb1 T C 2: 135,344,173 F687L probably benign Het
Plk5 G T 10: 80,360,569 probably null Het
Pnpla2 T A 7: 141,455,416 Y44N probably damaging Het
Ppp1r12a T A 10: 108,262,431 D337E possibly damaging Het
Prl2c5 G T 13: 13,190,773 probably null Het
Prom2 T C 2: 127,536,594 D460G probably damaging Het
Pros1 A G 16: 62,928,135 H657R possibly damaging Het
Prune2 A G 19: 17,123,492 E2120G probably damaging Het
Rap2a T A 14: 120,478,935 L70Q probably damaging Het
Rbl2 A T 8: 91,112,529 E858D probably benign Het
Rbm48 T C 5: 3,595,997 Y69C probably damaging Het
Rgs12 T A 5: 34,965,674 I267N probably damaging Het
Rpusd2 G T 2: 119,035,247 A142S probably benign Het
Rspo2 A T 15: 43,075,936 W153R probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Serinc5 T A 13: 92,706,263 M407K probably damaging Het
Slain2 T C 5: 72,957,322 S299P probably damaging Het
Slc17a4 A G 13: 23,900,545 Y419H possibly damaging Het
Slc1a6 T A 10: 78,791,349 D173E probably damaging Het
Slc22a19 A T 19: 7,711,141 I18N probably damaging Het
Slc37a3 A T 6: 39,359,968 F91L probably damaging Het
Spag5 C A 11: 78,304,455 T196K possibly damaging Het
Susd2 G T 10: 75,639,732 A326D probably damaging Het
Syna G T 5: 134,559,915 A60D probably damaging Het
Tchh A T 3: 93,447,760 E1502D unknown Het
Tecta T C 9: 42,392,024 H104R probably damaging Het
Tmed1 T C 9: 21,509,091 D102G probably damaging Het
Trip12 T C 1: 84,745,060 D128G probably damaging Het
Uroc1 A G 6: 90,361,524 M656V probably benign Het
Usp47 T A 7: 112,101,870 V1096D possibly damaging Het
Utp20 T A 10: 88,762,770 K115* probably null Het
Vmn2r19 G T 6: 123,331,638 probably null Het
Vmn2r86 A T 10: 130,446,386 V787D probably damaging Het
Vmn2r87 A T 10: 130,472,572 I599N possibly damaging Het
Vwf A G 6: 125,667,529 D2449G possibly damaging Het
Zbtb7c T A 18: 76,136,906 C22S probably benign Het
Zc3h7a A G 16: 11,147,304 I655T possibly damaging Het
Other mutations in Olfr1047
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Olfr1047 APN 2 86228629 missense possibly damaging 0.78
IGL01470:Olfr1047 APN 2 86228284 missense probably benign 0.26
IGL02179:Olfr1047 APN 2 86228247 nonsense probably null
IGL02703:Olfr1047 APN 2 86228979 utr 5 prime probably benign
R0370:Olfr1047 UTSW 2 86228713 missense probably damaging 0.99
R1452:Olfr1047 UTSW 2 86228455 missense probably damaging 0.99
R1655:Olfr1047 UTSW 2 86228080 missense possibly damaging 0.95
R1970:Olfr1047 UTSW 2 86228252 missense probably damaging 1.00
R2385:Olfr1047 UTSW 2 86228473 nonsense probably null
R3411:Olfr1047 UTSW 2 86228642 missense probably benign 0.08
R3730:Olfr1047 UTSW 2 86228851 missense probably benign 0.00
R4655:Olfr1047 UTSW 2 86228693 missense probably benign 0.26
R6168:Olfr1047 UTSW 2 86228594 missense probably damaging 0.99
R6190:Olfr1047 UTSW 2 86228234 missense possibly damaging 0.67
R6492:Olfr1047 UTSW 2 86228387 missense possibly damaging 0.91
Z1088:Olfr1047 UTSW 2 86228222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTAGTACCCAACATAACTTTTG -3'
(R):5'- TGTCCTGATGGGCATCACTG -3'

Sequencing Primer
(F):5'- CCCAACATAACTTTTGTGACATAATG -3'
(R):5'- ATCACTGACCGCCCTGAG -3'
Posted On2014-06-30