Incidental Mutation 'R1866:Plcb1'
ID208698
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Namephospholipase C, beta 1
Synonyms3110043I21Rik
MMRRC Submission 039889-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R1866 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location134786067-135475258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135344173 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 687 (F687L)
Ref Sequence ENSEMBL: ENSMUSP00000118756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
Predicted Effect probably benign
Transcript: ENSMUST00000070724
AA Change: F687L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: F687L

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110116
AA Change: F687L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: F687L

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131552
AA Change: F687L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: F687L

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153402
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 A T 19: 23,892,831 E9V probably benign Het
Armc8 T A 9: 99,536,280 T32S probably benign Het
Atr T A 9: 95,870,605 probably null Het
Blm A G 7: 80,494,114 L859P probably benign Het
Cacna2d3 A T 14: 28,969,214 F51L probably damaging Het
Cdcp2 A G 4: 107,107,000 N349S probably damaging Het
Cfap57 G A 4: 118,599,927 H442Y possibly damaging Het
Chrm3 A G 13: 9,878,481 L173P probably damaging Het
Cpb1 C G 3: 20,263,756 M201I probably benign Het
Dgcr8 A T 16: 18,258,314 N2K probably damaging Het
Dnah3 A T 7: 119,928,856 probably null Het
Dnah6 T A 6: 73,100,088 Q2398L probably benign Het
Dpep2 A T 8: 105,989,448 probably null Het
E430018J23Rik A G 7: 127,393,331 W36R probably damaging Het
Eif2ak4 C A 2: 118,472,661 T1504K probably damaging Het
Exoc6b A G 6: 84,851,914 V496A probably damaging Het
Fam174a A C 1: 95,313,895 S27R probably benign Het
Fat2 T A 11: 55,292,014 Q1339L probably benign Het
Fkbpl T A 17: 34,645,823 D188E possibly damaging Het
Focad A G 4: 88,407,165 D89G possibly damaging Het
Fstl4 C A 11: 53,186,398 Q661K probably benign Het
Gck T C 11: 5,903,253 Y289C probably benign Het
Gm156 A G 6: 129,775,380 probably null Het
Gm16181 T A 17: 35,223,937 probably benign Het
Herc1 G A 9: 66,450,791 G2385S probably damaging Het
Igfn1 T C 1: 135,974,868 probably null Het
Il12b T C 11: 44,408,526 W141R probably damaging Het
Itga6 T A 2: 71,834,070 S517T probably benign Het
Kank1 A G 19: 25,411,449 S801G probably benign Het
Lctl A G 9: 64,131,721 D205G probably damaging Het
Lhx3 A C 2: 26,203,974 V79G probably damaging Het
Lrrc9 T C 12: 72,497,138 I1127T probably damaging Het
Ltbp3 A T 19: 5,747,849 E505D probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map6 A G 7: 99,315,876 S291G probably damaging Het
Mapk7 A G 11: 61,489,413 F671L probably benign Het
Mau2 A G 8: 70,031,492 W149R probably damaging Het
Mb21d2 C T 16: 28,828,515 V236I possibly damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Mical1 C A 10: 41,485,470 P797Q probably benign Het
Mnx1 G A 5: 29,474,045 R347C unknown Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nlrp2 G T 7: 5,327,716 C560* probably null Het
Npat T A 9: 53,563,116 L736H probably damaging Het
Nup155 T A 15: 8,115,526 V147E probably damaging Het
Nxpe2 A G 9: 48,326,821 F45L probably benign Het
Obscn T C 11: 59,060,915 D4370G probably benign Het
Olfr1000 T A 2: 85,608,844 H22L probably benign Het
Olfr1047 A C 2: 86,228,728 M81R probably damaging Het
Olfr1252 T C 2: 89,721,206 K302E probably benign Het
Olfr1260 T C 2: 89,978,327 L183S probably damaging Het
Olfr1425 A G 19: 12,073,819 V271A probably benign Het
Olfr1532-ps1 A G 7: 106,915,066 I289M probably damaging Het
Olfr658 A G 7: 104,644,797 S190P probably benign Het
Pcx T C 19: 4,621,221 I1157T possibly damaging Het
Pias2 T A 18: 77,152,716 S589R probably benign Het
Plk5 G T 10: 80,360,569 probably null Het
Pnpla2 T A 7: 141,455,416 Y44N probably damaging Het
Ppp1r12a T A 10: 108,262,431 D337E possibly damaging Het
Prl2c5 G T 13: 13,190,773 probably null Het
Prom2 T C 2: 127,536,594 D460G probably damaging Het
Pros1 A G 16: 62,928,135 H657R possibly damaging Het
Prune2 A G 19: 17,123,492 E2120G probably damaging Het
Rap2a T A 14: 120,478,935 L70Q probably damaging Het
Rbl2 A T 8: 91,112,529 E858D probably benign Het
Rbm48 T C 5: 3,595,997 Y69C probably damaging Het
Rgs12 T A 5: 34,965,674 I267N probably damaging Het
Rpusd2 G T 2: 119,035,247 A142S probably benign Het
Rspo2 A T 15: 43,075,936 W153R probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Serinc5 T A 13: 92,706,263 M407K probably damaging Het
Slain2 T C 5: 72,957,322 S299P probably damaging Het
Slc17a4 A G 13: 23,900,545 Y419H possibly damaging Het
Slc1a6 T A 10: 78,791,349 D173E probably damaging Het
Slc22a19 A T 19: 7,711,141 I18N probably damaging Het
Slc37a3 A T 6: 39,359,968 F91L probably damaging Het
Spag5 C A 11: 78,304,455 T196K possibly damaging Het
Susd2 G T 10: 75,639,732 A326D probably damaging Het
Syna G T 5: 134,559,915 A60D probably damaging Het
Tchh A T 3: 93,447,760 E1502D unknown Het
Tecta T C 9: 42,392,024 H104R probably damaging Het
Tmed1 T C 9: 21,509,091 D102G probably damaging Het
Trip12 T C 1: 84,745,060 D128G probably damaging Het
Uroc1 A G 6: 90,361,524 M656V probably benign Het
Usp47 T A 7: 112,101,870 V1096D possibly damaging Het
Utp20 T A 10: 88,762,770 K115* probably null Het
Vmn2r19 G T 6: 123,331,638 probably null Het
Vmn2r86 A T 10: 130,446,386 V787D probably damaging Het
Vmn2r87 A T 10: 130,472,572 I599N possibly damaging Het
Vwf A G 6: 125,667,529 D2449G possibly damaging Het
Zbtb7c T A 18: 76,136,906 C22S probably benign Het
Zc3h7a A G 16: 11,147,304 I655T possibly damaging Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135251756 missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134813659 missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135220791 missense probably benign 0.03
IGL01999:Plcb1 APN 2 135346318 missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134786559 missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135387853 missense probably benign 0.08
IGL02207:Plcb1 APN 2 135387171 missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135472263 missense probably benign 0.17
IGL02590:Plcb1 APN 2 135294864 missense probably benign 0.08
IGL02640:Plcb1 APN 2 135220859 splice site probably benign
IGL02926:Plcb1 APN 2 135364762 splice site probably benign
IGL03071:Plcb1 APN 2 135387802 missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135346306 missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135370428 missense probably benign
IGL03387:Plcb1 APN 2 134813686 splice site probably benign
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0308:Plcb1 UTSW 2 134813614 missense probably benign 0.01
R0415:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135294911 missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135387143 missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135325657 missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135362444 splice site probably benign
R1617:Plcb1 UTSW 2 135337441 missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135325667 nonsense probably null
R1869:Plcb1 UTSW 2 135311014 missense probably benign 0.02
R1902:Plcb1 UTSW 2 134813613 missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135386302 missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135325667 nonsense probably null
R2132:Plcb1 UTSW 2 135325667 nonsense probably null
R2133:Plcb1 UTSW 2 135325667 nonsense probably null
R2164:Plcb1 UTSW 2 135346330 missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135262100 splice site probably benign
R2429:Plcb1 UTSW 2 135337442 missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135260508 missense probably benign 0.27
R3161:Plcb1 UTSW 2 135335482 missense probably benign 0.03
R3870:Plcb1 UTSW 2 135325671 missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135345090 missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135344158 missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4553:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4720:Plcb1 UTSW 2 135251747 missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135345095 missense probably benign 0.01
R5012:Plcb1 UTSW 2 135333400 missense probably null 0.97
R5151:Plcb1 UTSW 2 135262245 missense probably benign 0.28
R5320:Plcb1 UTSW 2 135252776 missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135347402 missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135260566 missense probably benign 0.08
R5568:Plcb1 UTSW 2 135370593 missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135335480 missense probably benign 0.06
R5809:Plcb1 UTSW 2 135262244 missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135370566 missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135346341 missense probably benign 0.00
R6478:Plcb1 UTSW 2 135335451 missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135325802 critical splice donor site probably null
R6683:Plcb1 UTSW 2 134786593 missense probably benign 0.32
R6760:Plcb1 UTSW 2 135472060 missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135386155 missense probably benign 0.08
R6976:Plcb1 UTSW 2 135262239 missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135370510 missense probably benign 0.45
R7473:Plcb1 UTSW 2 135344276 missense probably damaging 0.98
S24628:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135345054 missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135220846 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATCTGATTGGCTCCTAACCTG -3'
(R):5'- ACCCAGATAAACTTGCCTCTTG -3'

Sequencing Primer
(F):5'- TAACCTGCCCATTCTCACCCAG -3'
(R):5'- GCAACAGGCAGGAGACCC -3'
Posted On2014-06-30