Incidental Mutation 'R1866:Utp20'
ID208745
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 039889-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R1866 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 88762770 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 115 (K115*)
Ref Sequence ENSEMBL: ENSMUSP00000151748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470] [ENSMUST00000218967] [ENSMUST00000220188]
Predicted Effect probably null
Transcript: ENSMUST00000004470
AA Change: K2043*
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: K2043*

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218967
AA Change: K115*
Predicted Effect probably null
Transcript: ENSMUST00000220188
AA Change: K115*
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 A T 19: 23,892,831 E9V probably benign Het
Armc8 T A 9: 99,536,280 T32S probably benign Het
Atr T A 9: 95,870,605 probably null Het
Blm A G 7: 80,494,114 L859P probably benign Het
Cacna2d3 A T 14: 28,969,214 F51L probably damaging Het
Cdcp2 A G 4: 107,107,000 N349S probably damaging Het
Cfap57 G A 4: 118,599,927 H442Y possibly damaging Het
Chrm3 A G 13: 9,878,481 L173P probably damaging Het
Cpb1 C G 3: 20,263,756 M201I probably benign Het
Dgcr8 A T 16: 18,258,314 N2K probably damaging Het
Dnah3 A T 7: 119,928,856 probably null Het
Dnah6 T A 6: 73,100,088 Q2398L probably benign Het
Dpep2 A T 8: 105,989,448 probably null Het
E430018J23Rik A G 7: 127,393,331 W36R probably damaging Het
Eif2ak4 C A 2: 118,472,661 T1504K probably damaging Het
Exoc6b A G 6: 84,851,914 V496A probably damaging Het
Fam174a A C 1: 95,313,895 S27R probably benign Het
Fat2 T A 11: 55,292,014 Q1339L probably benign Het
Fkbpl T A 17: 34,645,823 D188E possibly damaging Het
Focad A G 4: 88,407,165 D89G possibly damaging Het
Fstl4 C A 11: 53,186,398 Q661K probably benign Het
Gck T C 11: 5,903,253 Y289C probably benign Het
Gm156 A G 6: 129,775,380 probably null Het
Gm16181 T A 17: 35,223,937 probably benign Het
Herc1 G A 9: 66,450,791 G2385S probably damaging Het
Igfn1 T C 1: 135,974,868 probably null Het
Il12b T C 11: 44,408,526 W141R probably damaging Het
Itga6 T A 2: 71,834,070 S517T probably benign Het
Kank1 A G 19: 25,411,449 S801G probably benign Het
Lctl A G 9: 64,131,721 D205G probably damaging Het
Lhx3 A C 2: 26,203,974 V79G probably damaging Het
Lrrc9 T C 12: 72,497,138 I1127T probably damaging Het
Ltbp3 A T 19: 5,747,849 E505D probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map6 A G 7: 99,315,876 S291G probably damaging Het
Mapk7 A G 11: 61,489,413 F671L probably benign Het
Mau2 A G 8: 70,031,492 W149R probably damaging Het
Mb21d2 C T 16: 28,828,515 V236I possibly damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Mical1 C A 10: 41,485,470 P797Q probably benign Het
Mnx1 G A 5: 29,474,045 R347C unknown Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nlrp2 G T 7: 5,327,716 C560* probably null Het
Npat T A 9: 53,563,116 L736H probably damaging Het
Nup155 T A 15: 8,115,526 V147E probably damaging Het
Nxpe2 A G 9: 48,326,821 F45L probably benign Het
Obscn T C 11: 59,060,915 D4370G probably benign Het
Olfr1000 T A 2: 85,608,844 H22L probably benign Het
Olfr1047 A C 2: 86,228,728 M81R probably damaging Het
Olfr1252 T C 2: 89,721,206 K302E probably benign Het
Olfr1260 T C 2: 89,978,327 L183S probably damaging Het
Olfr1425 A G 19: 12,073,819 V271A probably benign Het
Olfr1532-ps1 A G 7: 106,915,066 I289M probably damaging Het
Olfr658 A G 7: 104,644,797 S190P probably benign Het
Pcx T C 19: 4,621,221 I1157T possibly damaging Het
Pias2 T A 18: 77,152,716 S589R probably benign Het
Plcb1 T C 2: 135,344,173 F687L probably benign Het
Plk5 G T 10: 80,360,569 probably null Het
Pnpla2 T A 7: 141,455,416 Y44N probably damaging Het
Ppp1r12a T A 10: 108,262,431 D337E possibly damaging Het
Prl2c5 G T 13: 13,190,773 probably null Het
Prom2 T C 2: 127,536,594 D460G probably damaging Het
Pros1 A G 16: 62,928,135 H657R possibly damaging Het
Prune2 A G 19: 17,123,492 E2120G probably damaging Het
Rap2a T A 14: 120,478,935 L70Q probably damaging Het
Rbl2 A T 8: 91,112,529 E858D probably benign Het
Rbm48 T C 5: 3,595,997 Y69C probably damaging Het
Rgs12 T A 5: 34,965,674 I267N probably damaging Het
Rpusd2 G T 2: 119,035,247 A142S probably benign Het
Rspo2 A T 15: 43,075,936 W153R probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Serinc5 T A 13: 92,706,263 M407K probably damaging Het
Slain2 T C 5: 72,957,322 S299P probably damaging Het
Slc17a4 A G 13: 23,900,545 Y419H possibly damaging Het
Slc1a6 T A 10: 78,791,349 D173E probably damaging Het
Slc22a19 A T 19: 7,711,141 I18N probably damaging Het
Slc37a3 A T 6: 39,359,968 F91L probably damaging Het
Spag5 C A 11: 78,304,455 T196K possibly damaging Het
Susd2 G T 10: 75,639,732 A326D probably damaging Het
Syna G T 5: 134,559,915 A60D probably damaging Het
Tchh A T 3: 93,447,760 E1502D unknown Het
Tecta T C 9: 42,392,024 H104R probably damaging Het
Tmed1 T C 9: 21,509,091 D102G probably damaging Het
Trip12 T C 1: 84,745,060 D128G probably damaging Het
Uroc1 A G 6: 90,361,524 M656V probably benign Het
Usp47 T A 7: 112,101,870 V1096D possibly damaging Het
Vmn2r19 G T 6: 123,331,638 probably null Het
Vmn2r86 A T 10: 130,446,386 V787D probably damaging Het
Vmn2r87 A T 10: 130,472,572 I599N possibly damaging Het
Vwf A G 6: 125,667,529 D2449G possibly damaging Het
Zbtb7c T A 18: 76,136,906 C22S probably benign Het
Zc3h7a A G 16: 11,147,304 I655T possibly damaging Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7296:Utp20 UTSW 10 88770724 missense probably benign 0.21
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
R7330:Utp20 UTSW 10 88787562 frame shift probably null
R7367:Utp20 UTSW 10 88795443 missense probably benign 0.21
R7432:Utp20 UTSW 10 88798398 missense probably benign 0.00
R7447:Utp20 UTSW 10 88772492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAGTTCTCAGCCCAAACAG -3'
(R):5'- AGAATGTCGCTCTCTGTTTGC -3'

Sequencing Primer
(F):5'- GCTATCTAAACTAGGCTGGCC -3'
(R):5'- TGCCCATTTAGATCCTACAGAATAC -3'
Posted On2014-06-30