Incidental Mutation 'R1866:Apba1'
ID208782
Institutional Source Beutler Lab
Gene Symbol Apba1
Ensembl Gene ENSMUSG00000024897
Gene Nameamyloid beta (A4) precursor protein binding, family A, member 1
Synonyms6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha
MMRRC Submission 039889-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1866 (G1)
Quality Score96
Status Not validated
Chromosome19
Chromosomal Location23758876-23949597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23892831 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 9 (E9V)
Ref Sequence ENSEMBL: ENSMUSP00000025830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025830]
Predicted Effect probably benign
Transcript: ENSMUST00000025830
AA Change: E9V

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: E9V

DomainStartEndE-ValueType
low complexity region 40 47 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 404 421 N/A INTRINSIC
PTB 461 626 9.49e-33 SMART
PDZ 670 748 3.09e-15 SMART
PDZ 762 828 2.53e-11 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armc8 T A 9: 99,536,280 T32S probably benign Het
Atr T A 9: 95,870,605 probably null Het
Blm A G 7: 80,494,114 L859P probably benign Het
Cacna2d3 A T 14: 28,969,214 F51L probably damaging Het
Cdcp2 A G 4: 107,107,000 N349S probably damaging Het
Cfap57 G A 4: 118,599,927 H442Y possibly damaging Het
Chrm3 A G 13: 9,878,481 L173P probably damaging Het
Cpb1 C G 3: 20,263,756 M201I probably benign Het
Dgcr8 A T 16: 18,258,314 N2K probably damaging Het
Dnah3 A T 7: 119,928,856 probably null Het
Dnah6 T A 6: 73,100,088 Q2398L probably benign Het
Dpep2 A T 8: 105,989,448 probably null Het
E430018J23Rik A G 7: 127,393,331 W36R probably damaging Het
Eif2ak4 C A 2: 118,472,661 T1504K probably damaging Het
Exoc6b A G 6: 84,851,914 V496A probably damaging Het
Fam174a A C 1: 95,313,895 S27R probably benign Het
Fat2 T A 11: 55,292,014 Q1339L probably benign Het
Fkbpl T A 17: 34,645,823 D188E possibly damaging Het
Focad A G 4: 88,407,165 D89G possibly damaging Het
Fstl4 C A 11: 53,186,398 Q661K probably benign Het
Gck T C 11: 5,903,253 Y289C probably benign Het
Gm156 A G 6: 129,775,380 probably null Het
Gm16181 T A 17: 35,223,937 probably benign Het
Herc1 G A 9: 66,450,791 G2385S probably damaging Het
Igfn1 T C 1: 135,974,868 probably null Het
Il12b T C 11: 44,408,526 W141R probably damaging Het
Itga6 T A 2: 71,834,070 S517T probably benign Het
Kank1 A G 19: 25,411,449 S801G probably benign Het
Lctl A G 9: 64,131,721 D205G probably damaging Het
Lhx3 A C 2: 26,203,974 V79G probably damaging Het
Lrrc9 T C 12: 72,497,138 I1127T probably damaging Het
Ltbp3 A T 19: 5,747,849 E505D probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map6 A G 7: 99,315,876 S291G probably damaging Het
Mapk7 A G 11: 61,489,413 F671L probably benign Het
Mau2 A G 8: 70,031,492 W149R probably damaging Het
Mb21d2 C T 16: 28,828,515 V236I possibly damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Mical1 C A 10: 41,485,470 P797Q probably benign Het
Mnx1 G A 5: 29,474,045 R347C unknown Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nlrp2 G T 7: 5,327,716 C560* probably null Het
Npat T A 9: 53,563,116 L736H probably damaging Het
Nup155 T A 15: 8,115,526 V147E probably damaging Het
Nxpe2 A G 9: 48,326,821 F45L probably benign Het
Obscn T C 11: 59,060,915 D4370G probably benign Het
Olfr1000 T A 2: 85,608,844 H22L probably benign Het
Olfr1047 A C 2: 86,228,728 M81R probably damaging Het
Olfr1252 T C 2: 89,721,206 K302E probably benign Het
Olfr1260 T C 2: 89,978,327 L183S probably damaging Het
Olfr1425 A G 19: 12,073,819 V271A probably benign Het
Olfr1532-ps1 A G 7: 106,915,066 I289M probably damaging Het
Olfr658 A G 7: 104,644,797 S190P probably benign Het
Pcx T C 19: 4,621,221 I1157T possibly damaging Het
Pias2 T A 18: 77,152,716 S589R probably benign Het
Plcb1 T C 2: 135,344,173 F687L probably benign Het
Plk5 G T 10: 80,360,569 probably null Het
Pnpla2 T A 7: 141,455,416 Y44N probably damaging Het
Ppp1r12a T A 10: 108,262,431 D337E possibly damaging Het
Prl2c5 G T 13: 13,190,773 probably null Het
Prom2 T C 2: 127,536,594 D460G probably damaging Het
Pros1 A G 16: 62,928,135 H657R possibly damaging Het
Prune2 A G 19: 17,123,492 E2120G probably damaging Het
Rap2a T A 14: 120,478,935 L70Q probably damaging Het
Rbl2 A T 8: 91,112,529 E858D probably benign Het
Rbm48 T C 5: 3,595,997 Y69C probably damaging Het
Rgs12 T A 5: 34,965,674 I267N probably damaging Het
Rpusd2 G T 2: 119,035,247 A142S probably benign Het
Rspo2 A T 15: 43,075,936 W153R probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Serinc5 T A 13: 92,706,263 M407K probably damaging Het
Slain2 T C 5: 72,957,322 S299P probably damaging Het
Slc17a4 A G 13: 23,900,545 Y419H possibly damaging Het
Slc1a6 T A 10: 78,791,349 D173E probably damaging Het
Slc22a19 A T 19: 7,711,141 I18N probably damaging Het
Slc37a3 A T 6: 39,359,968 F91L probably damaging Het
Spag5 C A 11: 78,304,455 T196K possibly damaging Het
Susd2 G T 10: 75,639,732 A326D probably damaging Het
Syna G T 5: 134,559,915 A60D probably damaging Het
Tchh A T 3: 93,447,760 E1502D unknown Het
Tecta T C 9: 42,392,024 H104R probably damaging Het
Tmed1 T C 9: 21,509,091 D102G probably damaging Het
Trip12 T C 1: 84,745,060 D128G probably damaging Het
Uroc1 A G 6: 90,361,524 M656V probably benign Het
Usp47 T A 7: 112,101,870 V1096D possibly damaging Het
Utp20 T A 10: 88,762,770 K115* probably null Het
Vmn2r19 G T 6: 123,331,638 probably null Het
Vmn2r86 A T 10: 130,446,386 V787D probably damaging Het
Vmn2r87 A T 10: 130,472,572 I599N possibly damaging Het
Vwf A G 6: 125,667,529 D2449G possibly damaging Het
Zbtb7c T A 18: 76,136,906 C22S probably benign Het
Zc3h7a A G 16: 11,147,304 I655T possibly damaging Het
Other mutations in Apba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Apba1 APN 19 23917586 missense possibly damaging 0.95
IGL01991:Apba1 APN 19 23937472 missense possibly damaging 0.80
IGL02048:Apba1 APN 19 23937636 splice site probably null
IGL02522:Apba1 APN 19 23912445 splice site probably benign
IGL02728:Apba1 APN 19 23944905 missense possibly damaging 0.93
IGL02942:Apba1 APN 19 23944971 missense possibly damaging 0.78
IGL03349:Apba1 APN 19 23917575 missense probably benign 0.02
IGL03410:Apba1 APN 19 23937581 missense possibly damaging 0.67
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0084:Apba1 UTSW 19 23912497 missense possibly damaging 0.68
R0379:Apba1 UTSW 19 23934830 missense probably damaging 1.00
R0423:Apba1 UTSW 19 23944998 missense probably damaging 1.00
R1132:Apba1 UTSW 19 23917553 missense possibly damaging 0.83
R1291:Apba1 UTSW 19 23917672 missense probably damaging 0.97
R1681:Apba1 UTSW 19 23936561 missense probably damaging 1.00
R1714:Apba1 UTSW 19 23944952 missense possibly damaging 0.67
R1756:Apba1 UTSW 19 23893692 missense possibly damaging 0.83
R2076:Apba1 UTSW 19 23893223 nonsense probably null
R2217:Apba1 UTSW 19 23893962 missense probably damaging 0.99
R3907:Apba1 UTSW 19 23937506 missense probably damaging 0.96
R4095:Apba1 UTSW 19 23944024 missense probably benign 0.00
R4529:Apba1 UTSW 19 23936535 missense probably damaging 1.00
R4557:Apba1 UTSW 19 23917592 missense probably damaging 1.00
R4972:Apba1 UTSW 19 23912536 missense probably benign 0.24
R5521:Apba1 UTSW 19 23893593 missense probably damaging 1.00
R6539:Apba1 UTSW 19 23936560 missense probably damaging 1.00
R7032:Apba1 UTSW 19 23912461 missense probably benign 0.20
R7035:Apba1 UTSW 19 23917567 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTCAGCAGGGATCAATAGCGAG -3'
(R):5'- TGTAGACGTAGCCCGAGTAG -3'

Sequencing Primer
(F):5'- ATCAATAGCGAGTGGTTTTATGTC -3'
(R):5'- TTGTGGAAGCCGCTCTCG -3'
Posted On2014-06-30