Incidental Mutation 'R1867:Ubr5'
ID208873
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1867 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38041846 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 169 (S169T)
Ref Sequence ENSEMBL: ENSMUSP00000105965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect probably benign
Transcript: ENSMUST00000110336
AA Change: S169T

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: S169T

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226414
AA Change: S169T

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A T 5: 66,000,217 M1K probably null Het
Abca4 T A 3: 122,105,361 I664N probably damaging Het
Acin1 T C 14: 54,644,261 D335G probably damaging Het
Acoxl A G 2: 127,877,787 Y156C probably damaging Het
Adamts20 A G 15: 94,338,459 F844L probably benign Het
Ago1 A G 4: 126,441,236 Y398H probably damaging Het
Aldob A G 4: 49,543,835 V49A possibly damaging Het
Arhgap18 A G 10: 26,846,030 E71G probably damaging Het
Asb12 G T X: 95,470,344 H307N probably damaging Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
AY358078 T C 14: 51,800,047 M1T probably null Het
BC117090 T G 16: 36,321,786 D76A possibly damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Brpf3 A G 17: 28,807,368 M472V probably benign Het
Bsn A G 9: 108,106,719 S3379P unknown Het
Cap2 T C 13: 46,640,079 V333A probably damaging Het
Ccdc173 A T 2: 69,781,837 probably null Het
Cd207 T A 6: 83,675,653 D165V probably damaging Het
Cmtr1 A G 17: 29,674,174 T496A probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Cstb A G 10: 78,427,439 *99W probably null Het
Ddx11 G A 17: 66,135,939 probably null Het
Dip2c T C 13: 9,621,949 M990T possibly damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Fmn1 A G 2: 113,709,438 E1326G probably damaging Het
Focad A T 4: 88,178,089 D236V probably damaging Het
Fsd1 G A 17: 55,991,254 S193N probably benign Het
Gm4922 T A 10: 18,784,463 R170S possibly damaging Het
Gm5129 T C 5: 29,735,656 probably benign Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Hspbap1 A T 16: 35,801,564 Y93F possibly damaging Het
Iars2 A T 1: 185,318,568 D441E probably benign Het
Il1rap A T 16: 26,722,926 H639L probably damaging Het
Inhbc A T 10: 127,357,547 V200E probably benign Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Intu G T 3: 40,664,335 G257V probably damaging Het
Kif23 C A 9: 61,918,961 A929S possibly damaging Het
Kmt2b A T 7: 30,574,658 V2207E possibly damaging Het
Ksr2 A C 5: 117,505,529 E121A probably benign Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lpl TGG TG 8: 68,896,602 probably null Het
Mcmdc2 T C 1: 9,930,805 V435A probably damaging Het
Mecom A G 3: 30,509,428 probably null Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Mmp16 A T 4: 18,116,013 D539V probably benign Het
Mpp1 A G X: 75,125,369 probably null Het
Mpp2 C T 11: 102,064,667 E86K probably benign Het
Mtor T A 4: 148,454,632 F195L probably damaging Het
Myo3a T C 2: 22,399,846 I663T probably benign Het
Nlrp5 G A 7: 23,423,982 G756E possibly damaging Het
Nudt18 T C 14: 70,579,895 L255P probably damaging Het
Nup62 T A 7: 44,829,048 S162R possibly damaging Het
Olfr1097 A G 2: 86,890,612 S188P probably damaging Het
Olfr659 T A 7: 104,671,317 I205N possibly damaging Het
Olfr798 A T 10: 129,625,752 I103K probably damaging Het
Olfr835 G A 9: 19,035,266 A48T probably benign Het
Oosp2 C T 19: 11,649,595 probably null Het
Pan2 A G 10: 128,313,181 D506G probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Pcdhgc5 T G 18: 37,821,418 S582A possibly damaging Het
Pdik1l T C 4: 134,278,911 D70G probably damaging Het
Peg12 T C 7: 62,463,668 H227R probably benign Het
Pms1 C T 1: 53,189,387 V901I probably benign Het
Pnisr C T 4: 21,874,086 probably benign Het
Pole A G 5: 110,334,197 E135G probably benign Het
Ppp6r2 C A 15: 89,281,938 A715E probably benign Het
Prickle4 T G 17: 47,690,119 H174P possibly damaging Het
Prl2a1 T C 13: 27,804,940 L16P probably damaging Het
Prss32 C T 17: 23,853,894 T33M probably benign Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Rbbp6 T C 7: 122,997,029 V598A probably damaging Het
Rbm34 C A 8: 126,970,881 A27S probably benign Het
Rbm4b A G 19: 4,762,303 T247A probably benign Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Sema4f T C 6: 82,917,843 D457G possibly damaging Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Serpina3a A T 12: 104,118,627 I94L probably benign Het
Skida1 TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 2: 18,046,344 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Sntg2 T C 12: 30,236,651 N315D probably benign Het
Snx10 T A 6: 51,575,910 V11E probably damaging Het
Spta1 A G 1: 174,219,839 E1683G probably benign Het
Ssc5d A T 7: 4,928,507 R238W probably damaging Het
Ssh1 A T 5: 113,943,451 F617L probably damaging Het
Taf1 T G X: 101,562,957 M1254R probably damaging Het
Tcirg1 A G 19: 3,898,835 L450P probably damaging Het
Ticam1 C A 17: 56,271,718 A126S probably benign Het
Tnxb T A 17: 34,671,847 V388E probably damaging Het
Tomm5 A G 4: 45,107,939 L32P probably damaging Het
Usp28 T G 9: 49,009,194 D240E probably benign Het
Usp34 T C 11: 23,361,593 Y462H possibly damaging Het
Utp14b C A 1: 78,665,431 Q349K probably damaging Het
Utp20 G T 10: 88,749,443 D2586E probably benign Het
Vmn1r173 A G 7: 23,703,235 I298M unknown Het
Vmn1r37 T A 6: 66,731,477 I29K probably benign Het
Vmn2r23 G A 6: 123,702,915 G32D probably damaging Het
Xpo7 A T 14: 70,693,991 F296I probably damaging Het
Zfhx4 A G 3: 5,412,714 E3463G probably damaging Het
Zfp455 G T 13: 67,207,445 R194L probably benign Het
Zfp663 T C 2: 165,352,731 T523A possibly damaging Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACTTCTCGATTTGCCTTGTAG -3'
(R):5'- GTATGCAGATATTCAACAAAGGTGG -3'

Sequencing Primer
(F):5'- GCCTTGTAGAACAACTTGTGC -3'
(R):5'- TGTACAAGAATGAGACTCAAAATGAC -3'
Posted On2014-06-30