Incidental Mutation 'R1867:Adamts20'
ID208876
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Stock #R1867 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94338459 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 844 (F844L)
Ref Sequence ENSEMBL: ENSMUSP00000036330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342] [ENSMUST00000155907]
Predicted Effect probably benign
Transcript: ENSMUST00000035342
AA Change: F844L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: F844L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155907
AA Change: F844L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449
AA Change: F844L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 1e-31 PFAM
Pfam:Reprolysin_5 253 445 2.7e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 2.4e-28 PFAM
Pfam:Reprolysin_2 272 454 4e-10 PFAM
Pfam:Reprolysin_3 276 410 1.1e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype Homozygous mutants have a white belt across the back in the midtrunk region and a white belly patch that coalesces to form a white belt.
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A T 5: 66,000,217 M1K probably null Het
Abca4 T A 3: 122,105,361 I664N probably damaging Het
Acin1 T C 14: 54,644,261 D388G probably damaging Het
Acoxl A G 2: 127,877,787 Y156C probably damaging Het
Ago1 A G 4: 126,441,236 Y398H probably damaging Het
Aldob A G 4: 49,543,835 V49A possibly damaging Het
Arhgap18 A G 10: 26,846,030 E71G probably damaging Het
Asb12 G T X: 95,470,344 H307N probably damaging Homo
Atp2b1 T C 10: 98,996,888 V417A possibly damaging Het
AY358078 T C 14: 51,800,047 M1T probably null Het
BC117090 T G 16: 36,321,786 D76A possibly damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Bfsp2 T C 9: 103,479,723 noncoding transcript Het
Brpf3 A G 17: 28,807,368 M472V probably benign Het
Bsn A G 9: 108,106,719 S3379P unknown Het
Cap2 T C 13: 46,640,079 V388A probably damaging Het
Ccdc132 T C 6: 3,598,469 noncoding transcript Het
Ccdc173 A T 2: 69,781,837 probably null Het
Cd207 T A 6: 83,675,653 D165V probably damaging Het
Cmtr1 A G 17: 29,674,174 T496A probably benign Het
Col14a1 T A 15: 55,447,462 D1195E unknown Het
Cstb A G 10: 78,427,439 *99W probably null Het
D10Wsu102e A G 10: 83,360,377 Het
Ddx11 G A 17: 66,135,939 probably null Het
Dip2c T C 13: 9,621,949 M990T possibly damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Fmn1 A G 2: 113,709,438 E1460G probably damaging Het
Focad A T 4: 88,178,089 D236V probably damaging Het
Fsd1 G A 17: 55,991,254 S193N probably benign Het
Gm4922 T A 10: 18,784,463 R170S possibly damaging Het
Gm5129 T C 5: 29,735,656 D94G unknown Het
Gmeb1 G A 4: 132,246,082 noncoding transcript Het
Grm8 C G 6: 28,125,606 noncoding transcript Het
Gucy2d T A 7: 98,454,061 L503H probably benign Het
Hspbap1 A T 16: 35,801,564 Y93F possibly damaging Het
Iars2 A T 1: 185,318,568 D441E probably benign Het
Il1rap A T 16: 26,722,926 H639L probably damaging Het
Inhbc A T 10: 127,357,547 V200E probably benign Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Intu G T 3: 40,664,335 G257V probably damaging Het
Kif23 C A 9: 61,918,961 A929S possibly damaging Het
Kmt2b A T 7: 30,574,658 V2216E possibly damaging Het
Ksr2 A C 5: 117,505,529 E121A probably benign Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lcn10 A G 2: 25,684,016 noncoding transcript Het
Lpl TGG TG 8: 68,896,602 probably null Het
Mcmdc2 T C 1: 9,930,805 V435A probably damaging Het
Mdn1 T C 4: 32,730,997 noncoding transcript Het
Mecom A G 3: 30,509,428 probably null Het
Med12l T C 3: 59,247,492 Het
Mier2 A G 10: 79,548,830 V148A probably damaging Het
Mmp16 A T 4: 18,116,013 D539V probably benign Het
Mpp1 A G X: 75,125,369 probably null Homo
Mpp2 C T 11: 102,064,667 E86K probably benign Het
Mtor T A 4: 148,454,632 F195L probably damaging Het
Myo3a T C 2: 22,399,846 I663T probably benign Het
Nlrp5 G A 7: 23,423,982 G756E possibly damaging Het
Nudt18 T C 14: 70,579,895 L313P probably damaging Het
Nup62 T A 7: 44,829,048 S162R possibly damaging Het
Olfr1097 A G 2: 86,890,612 S188P probably damaging Het
Olfr659 T A 7: 104,671,317 I205N possibly damaging Het
Olfr798 A T 10: 129,625,752 I103K probably damaging Het
Olfr835 G A 9: 19,035,266 A48T probably benign Het
Oosp2 C T 19: 11,649,595 probably null Het
Pan2 A G 10: 128,313,181 D506G probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Pcdhga11 T G 18: 37,821,418 S582A possibly damaging Het
Pdik1l T C 4: 134,278,911 D70G probably damaging Het
Peg12 T C 7: 62,463,668 H227R probably benign Het
Pik3c2b T C 1: 133,101,320 Het
Pms1 C T 1: 53,189,387 V901I probably benign Het
Pnisr C T 4: 21,874,086 R610W unknown Het
Pole A G 5: 110,334,197 E135G probably benign Het
Ppp6r2 C A 15: 89,281,938 A715E probably benign Het
Prickle4 T G 17: 47,690,119 H174P possibly damaging Het
Prl2a1 T C 13: 27,804,940 L16P probably damaging Het
Prss32 C T 17: 23,853,894 T33M probably benign Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Rbbp6 T C 7: 122,997,029 V560A probably benign Het
Rbm34 C A 8: 126,970,881 A27S probably benign Het
Rbm4b A G 19: 4,762,303 T247A probably benign Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Sema4f T C 6: 82,917,843 D457G possibly damaging Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Serpina3a A T 12: 104,118,627 I94L probably benign Het
Skida1 TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 2: 18,046,344 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Sntg2 T C 12: 30,236,651 N315D probably benign Het
Snx10 T A 6: 51,575,910 V11E probably damaging Het
Spta1 A G 1: 174,219,839 E1683G probably benign Het
Ssc5d A T 7: 4,928,507 R238W probably damaging Het
Ssh1 A T 5: 113,943,451 F617L probably damaging Het
Taf1 T G X: 101,562,957 M1254R probably damaging Homo
Tcirg1 A G 19: 3,898,835 L450P probably damaging Het
Ticam1 C A 17: 56,271,718 A126S probably benign Het
Tnxb T A 17: 34,671,847 V388E probably damaging Het
Tomm5 A G 4: 45,107,939 L32P probably damaging Het
Trpm2 A G 10: 77,913,790 noncoding transcript Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp28 T G 9: 49,009,194 D240E probably benign Het
Usp34 T C 11: 23,361,593 Y462H possibly damaging Het
Utp14b C A 1: 78,665,431 Q349K probably damaging Het
Utp20 G T 10: 88,749,443 D2586E probably benign Het
Vmn1r173 A G 7: 23,703,235 I298M unknown Het
Vmn1r37 T A 6: 66,731,477 I29K probably benign Het
Vmn2r23 G A 6: 123,702,915 G32D probably damaging Het
Xpo7 A T 14: 70,693,991 F295I probably damaging Het
Zfhx4 A G 3: 5,412,714 E3463G probably damaging Het
Zfp455 G T 13: 67,207,445 R194L probably benign Het
Zfp663 T C 2: 165,352,731 T523A possibly damaging Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 unclassified probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 unclassified probably null
IGL03088:Adamts20 APN 15 94329914 unclassified probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense
panda UTSW 15 94326699 nonsense
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense
splotch2 UTSW 15 94335561 splice acceptor site
Wash UTSW 15 94347670 nonsense
whitebelly UTSW 15 unclassified
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice acceptor site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1691:Adamts20 UTSW 15 94403565 splice acceptor site noncoding transcript
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2068:Adamts20 UTSW 15 94282458 splice donor site
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2331:Adamts20 UTSW 15 94283087 splice acceptor site
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2484:Adamts20 UTSW 15 94403360 missense silent
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site unknown
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 synonymous probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTTGGTTAGCCACAAGG -3'
(R):5'- TTGTGACGTGCTTGCCATTATC -3'

Sequencing Primer
(F):5'- ACAGGGTACGTTGCAAGCC -3'
(R):5'- GCTTGCCATTATCAGCTATAAAAAC -3'
Posted OnJun 30, 2014