Incidental Mutation 'R1868:Vcan'
ID208994
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Nameversican
SynonymsPG-M, hdf, DPEAAE, heart defect, Cspg2, 5430420N07Rik
MMRRC Submission 039890-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1868 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location89655312-89742509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89690871 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2185 (S2185P)
Ref Sequence ENSEMBL: ENSMUSP00000105173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
Predicted Effect probably benign
Transcript: ENSMUST00000109543
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109544
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109546
AA Change: S2185P

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: S2185P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159910
AA Change: S1225P

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614
AA Change: S1225P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (115/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A T 5: 66,000,217 M1K probably null Het
9330182L06Rik T A 5: 9,479,251 I1028K probably damaging Het
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
A630073D07Rik C T 6: 132,626,494 E100K unknown Het
Abcc3 T G 11: 94,364,063 D638A probably benign Het
Acadm T C 3: 153,930,252 I272V probably benign Het
Adam2 G A 14: 66,077,658 T22I probably damaging Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Arfgef3 A T 10: 18,661,387 I182K probably benign Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Brca1 T A 11: 101,498,013 H1675L probably benign Het
Btd G T 14: 31,667,309 G329V probably benign Het
Capsl T A 15: 9,461,830 L104* probably null Het
Cbx1 T C 11: 96,802,728 S107P probably benign Het
Cd207 G T 6: 83,671,701 Y326* probably null Het
Cenpp T C 13: 49,641,283 D136G probably damaging Het
Chsy3 A G 18: 59,176,488 probably null Het
Cntrl T A 2: 35,129,815 H551Q probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Cybrd1 T A 2: 71,137,634 F183Y possibly damaging Het
D5Ertd577e T A 5: 95,482,899 Y212N probably benign Het
D5Ertd579e G A 5: 36,616,427 S208L probably damaging Het
Dlg2 A T 7: 92,386,952 K719* probably null Het
Dppa1 A T 11: 46,625,566 probably null Het
Dse A G 10: 34,153,288 V602A possibly damaging Het
Elmo1 C T 13: 20,589,653 A611V possibly damaging Het
Ets2 T C 16: 95,715,074 S233P probably benign Het
Fam129a A G 1: 151,641,551 S104G possibly damaging Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam198a A G 9: 121,965,427 T216A possibly damaging Het
Fchsd2 G A 7: 101,250,438 probably benign Het
Fkbp4 T C 6: 128,432,490 R402G probably benign Het
G2e3 T A 12: 51,353,629 D21E probably benign Het
Gck A T 11: 5,902,165 N391K probably damaging Het
Gm11077 T A 6: 140,729,291 I3N unknown Het
Gm13762 T C 2: 88,973,784 T36A possibly damaging Het
Gm6793 T C 8: 112,014,456 M185V probably benign Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Hat1 T A 2: 71,421,283 Y225* probably null Het
Iars2 A T 1: 185,318,568 D441E probably benign Het
Ido2 C A 8: 24,553,760 M92I possibly damaging Het
Ifne T C 4: 88,879,671 E170G probably damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Intu G T 3: 40,664,335 G257V probably damaging Het
Jakmip3 A G 7: 139,007,587 K140R probably benign Het
Kcnip3 T C 2: 127,459,343 E237G probably damaging Het
Ksr2 A C 5: 117,505,529 E121A probably benign Het
Lars T A 18: 42,214,837 I974F probably benign Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lhfpl4 T A 6: 113,176,433 D125V probably benign Het
Luc7l G A 17: 26,280,056 probably benign Het
Mei1 T C 15: 82,124,953 L833P probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Muc4 C T 16: 32,756,341 R2072C unknown Het
Myh3 A G 11: 67,085,026 K295E probably benign Het
Ndufaf5 A G 2: 140,181,589 I115V probably benign Het
Neb T C 2: 52,326,744 K140E probably damaging Het
Npas2 A G 1: 39,300,678 D103G probably benign Het
Ntrk3 A T 7: 78,192,604 H825Q possibly damaging Het
Nup62 T A 7: 44,829,048 S162R possibly damaging Het
Olfr1000 T A 2: 85,608,065 I282F probably damaging Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr143 A G 9: 38,253,690 E91G probably damaging Het
Orc4 A G 2: 48,910,293 M281T probably benign Het
Osbpl5 C A 7: 143,715,773 R22L probably damaging Het
Otos A G 1: 92,644,463 F47S probably damaging Het
Parp11 A G 6: 127,470,777 T25A probably damaging Het
Pcdhb9 A C 18: 37,402,084 D377A probably damaging Het
Pdgfra C T 5: 75,170,873 S348L probably benign Het
Pdlim5 C A 3: 142,306,299 probably null Het
Peg12 T C 7: 62,463,668 H227R probably benign Het
Piezo2 T C 18: 63,019,344 E2559G probably damaging Het
Pnisr C T 4: 21,874,086 probably benign Het
Ppa2 A T 3: 133,348,097 I183F probably damaging Het
Prl2a1 T C 13: 27,804,940 L16P probably damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rbm34 C A 8: 126,970,881 A27S probably benign Het
Rchy1 T C 5: 91,951,903 D192G probably damaging Het
Rexo1 T C 10: 80,542,920 D1094G probably damaging Het
Rtl1 T A 12: 109,590,536 D1623V probably damaging Het
Ryr2 C T 13: 11,731,700 E1989K probably benign Het
Sema6c A G 3: 95,170,813 E500G probably damaging Het
Slc13a1 T A 6: 24,118,000 Y246F probably damaging Het
Slc39a9 C T 12: 80,679,523 L249F probably damaging Het
Slc6a21 C T 7: 45,287,828 P261S probably benign Het
Slco2b1 C T 7: 99,686,036 C179Y probably damaging Het
Sox6 T C 7: 115,659,538 N252S possibly damaging Het
Spr-ps1 C T 6: 85,155,903 noncoding transcript Het
Sptbn1 C A 11: 30,114,781 R1906L possibly damaging Het
Stac2 T C 11: 98,052,945 D13G probably benign Het
Stat5a G T 11: 100,874,129 R226L probably damaging Het
Suz12 A G 11: 80,013,599 probably null Het
Tas2r144 C A 6: 42,216,002 H225Q probably benign Het
Tdo2 T A 3: 81,960,546 M331L probably benign Het
Tesk1 T C 4: 43,447,201 W530R probably damaging Het
Tlr6 T C 5: 64,954,829 N245S probably benign Het
Tnfrsf11a G T 1: 105,844,705 A573S probably damaging Het
Tpbpb A T 13: 60,902,530 probably benign Het
Trim24 T A 6: 37,951,512 S590T probably damaging Het
Ttll3 G T 6: 113,392,764 A90S possibly damaging Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp28 T C 9: 49,016,707 V363A probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r3 G A 3: 64,259,116 P865S probably damaging Het
Wapl A G 14: 34,692,458 T426A probably benign Het
Wdr37 G T 13: 8,836,851 T300K probably damaging Het
Wrap53 A T 11: 69,562,164 V439E probably null Het
Wrn A G 8: 33,257,221 S868P probably benign Het
Zfhx4 A G 3: 5,412,714 E3463G probably damaging Het
Zfp189 T A 4: 49,529,283 C129S possibly damaging Het
Zfp442 T C 2: 150,408,180 K544E probably damaging Het
Zfp939 T A 7: 39,473,304 noncoding transcript Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89704702 missense probably damaging 1.00
IGL00502:Vcan APN 13 89692319 missense probably benign
IGL00504:Vcan APN 13 89691275 missense possibly damaging 0.70
IGL00566:Vcan APN 13 89688979 missense probably benign 0.01
IGL00701:Vcan APN 13 89703726 missense probably benign
IGL00743:Vcan APN 13 89725306 missense probably damaging 0.98
IGL00962:Vcan APN 13 89662052 missense probably damaging 1.00
IGL01085:Vcan APN 13 89679958 missense probably damaging 1.00
IGL01317:Vcan APN 13 89691668 missense probably benign 0.00
IGL01349:Vcan APN 13 89703943 missense probably damaging 0.98
IGL01391:Vcan APN 13 89704169 missense probably benign 0.19
IGL01644:Vcan APN 13 89688675 missense probably benign 0.13
IGL01657:Vcan APN 13 89690586 missense probably damaging 1.00
IGL01707:Vcan APN 13 89689745 missense probably damaging 1.00
IGL01764:Vcan APN 13 89725388 missense probably damaging 1.00
IGL01920:Vcan APN 13 89689205 missense probably benign 0.04
IGL01989:Vcan APN 13 89689359 missense possibly damaging 0.86
IGL01999:Vcan APN 13 89684438 missense probably damaging 1.00
IGL02083:Vcan APN 13 89725565 missense probably damaging 1.00
IGL02160:Vcan APN 13 89684493 missense probably damaging 1.00
IGL02217:Vcan APN 13 89703077 missense probably damaging 1.00
IGL02522:Vcan APN 13 89704849 missense probably benign 0.00
IGL02527:Vcan APN 13 89690657 missense possibly damaging 0.95
IGL02926:Vcan APN 13 89688623 missense probably damaging 0.98
IGL03061:Vcan APN 13 89703275 missense probably benign 0.25
IGL03331:Vcan APN 13 89661932 missense probably damaging 1.00
IGL03352:Vcan APN 13 89705006 missense probably benign 0.00
R0041:Vcan UTSW 13 89661985 missense probably damaging 1.00
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0109:Vcan UTSW 13 89678073 critical splice donor site probably null
R0139:Vcan UTSW 13 89691261 missense probably damaging 1.00
R0295:Vcan UTSW 13 89712191 missense probably benign 0.06
R0375:Vcan UTSW 13 89691275 missense probably damaging 0.99
R0379:Vcan UTSW 13 89703546 missense probably damaging 0.99
R0457:Vcan UTSW 13 89703199 missense possibly damaging 0.78
R0482:Vcan UTSW 13 89678145 missense probably damaging 1.00
R0485:Vcan UTSW 13 89704660 missense possibly damaging 0.92
R0532:Vcan UTSW 13 89703772 missense probably damaging 0.99
R0561:Vcan UTSW 13 89712253 missense probably damaging 1.00
R0561:Vcan UTSW 13 89731464 missense possibly damaging 0.86
R0636:Vcan UTSW 13 89704706 missense probably damaging 0.99
R0636:Vcan UTSW 13 89712267 missense probably damaging 1.00
R0680:Vcan UTSW 13 89679822 missense probably damaging 1.00
R0849:Vcan UTSW 13 89704953 missense possibly damaging 0.75
R1006:Vcan UTSW 13 89685077 critical splice donor site probably null
R1104:Vcan UTSW 13 89692410 missense probably damaging 1.00
R1118:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1137:Vcan UTSW 13 89704303 missense probably damaging 1.00
R1199:Vcan UTSW 13 89679794 splice site probably null
R1219:Vcan UTSW 13 89679904 missense probably damaging 1.00
R1296:Vcan UTSW 13 89657556 missense probably damaging 1.00
R1332:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1336:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1546:Vcan UTSW 13 89692956 missense probably damaging 0.99
R1604:Vcan UTSW 13 89689661 missense probably benign 0.42
R1616:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1636:Vcan UTSW 13 89703667 missense possibly damaging 0.90
R1654:Vcan UTSW 13 89661946 missense probably damaging 1.00
R1680:Vcan UTSW 13 89703547 missense probably benign 0.19
R1694:Vcan UTSW 13 89688483 missense probably damaging 0.98
R1712:Vcan UTSW 13 89721775 missense probably damaging 1.00
R1754:Vcan UTSW 13 89704735 missense probably benign 0.01
R1756:Vcan UTSW 13 89691681 missense probably benign 0.05
R1824:Vcan UTSW 13 89705212 missense possibly damaging 0.75
R1852:Vcan UTSW 13 89705392 missense probably damaging 0.99
R1920:Vcan UTSW 13 89693015 missense probably damaging 1.00
R1932:Vcan UTSW 13 89705534 missense possibly damaging 0.78
R1934:Vcan UTSW 13 89702926 missense probably damaging 1.00
R1942:Vcan UTSW 13 89703424 missense probably benign 0.01
R1964:Vcan UTSW 13 89692742 missense probably benign 0.02
R1970:Vcan UTSW 13 89689038 missense probably damaging 1.00
R2045:Vcan UTSW 13 89690985 missense probably benign 0.00
R2110:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2111:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2112:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2136:Vcan UTSW 13 89689737 missense probably damaging 1.00
R2158:Vcan UTSW 13 89703529 missense possibly damaging 0.68
R2376:Vcan UTSW 13 89703410 missense possibly damaging 0.80
R2385:Vcan UTSW 13 89689449 missense probably damaging 1.00
R2443:Vcan UTSW 13 89704675 missense probably damaging 1.00
R2876:Vcan UTSW 13 89704237 missense probably damaging 1.00
R3607:Vcan UTSW 13 89703301 missense probably damaging 0.98
R4042:Vcan UTSW 13 89692543 missense probably benign 0.35
R4043:Vcan UTSW 13 89692543 missense probably benign 0.35
R4044:Vcan UTSW 13 89692543 missense probably benign 0.35
R4065:Vcan UTSW 13 89679887 missense probably damaging 1.00
R4161:Vcan UTSW 13 89685158 missense probably damaging 1.00
R4178:Vcan UTSW 13 89725547 missense probably damaging 1.00
R4290:Vcan UTSW 13 89725486 missense probably damaging 1.00
R4530:Vcan UTSW 13 89704028 missense probably damaging 0.97
R4666:Vcan UTSW 13 89679934 missense probably damaging 1.00
R4785:Vcan UTSW 13 89705789 missense probably damaging 1.00
R4870:Vcan UTSW 13 89704739 missense probably benign 0.01
R4973:Vcan UTSW 13 89688842 missense probably benign 0.30
R5037:Vcan UTSW 13 89703977 missense probably damaging 1.00
R5104:Vcan UTSW 13 89657472 intron probably benign
R5124:Vcan UTSW 13 89725517 missense probably damaging 1.00
R5129:Vcan UTSW 13 89690240 missense probably damaging 1.00
R5198:Vcan UTSW 13 89690872 missense probably damaging 1.00
R5240:Vcan UTSW 13 89692532 missense probably benign 0.08
R5254:Vcan UTSW 13 89691600 missense probably damaging 0.99
R5280:Vcan UTSW 13 89690286 missense probably benign 0.00
R5522:Vcan UTSW 13 89691810 missense possibly damaging 0.62
R5557:Vcan UTSW 13 89703112 missense possibly damaging 0.77
R5568:Vcan UTSW 13 89688671 missense probably damaging 1.00
R5578:Vcan UTSW 13 89691503 missense probably benign 0.01
R5627:Vcan UTSW 13 89691135 frame shift probably null
R5687:Vcan UTSW 13 89678134 missense probably damaging 1.00
R5752:Vcan UTSW 13 89679950 missense probably damaging 1.00
R5879:Vcan UTSW 13 89703952 missense probably damaging 0.99
R5941:Vcan UTSW 13 89692691 missense probably damaging 0.98
R6113:Vcan UTSW 13 89657536 nonsense probably null
R6135:Vcan UTSW 13 89689926 missense probably benign 0.36
R6252:Vcan UTSW 13 89691220 nonsense probably null
R6280:Vcan UTSW 13 89725373 missense probably damaging 1.00
R6317:Vcan UTSW 13 89691597 missense probably benign 0.22
R6327:Vcan UTSW 13 89704832 missense probably damaging 0.99
R6460:Vcan UTSW 13 89690687 missense possibly damaging 0.61
R6669:Vcan UTSW 13 89704731 missense probably benign 0.21
R6744:Vcan UTSW 13 89705182 missense probably damaging 1.00
R6819:Vcan UTSW 13 89705125 missense probably benign 0.00
R6880:Vcan UTSW 13 89712381 missense probably damaging 1.00
R6956:Vcan UTSW 13 89689431 missense probably damaging 0.99
R6971:Vcan UTSW 13 89678133 missense probably damaging 1.00
R6985:Vcan UTSW 13 89679956 missense probably damaging 1.00
X0058:Vcan UTSW 13 89692493 missense probably benign 0.21
X0065:Vcan UTSW 13 89705749 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTTCATGTCAGTCAAATTCACTG -3'
(R):5'- GCACCAGAACAAACCATTTTGG -3'

Sequencing Primer
(F):5'- CAGTCAAATTCACTGATGTTGTAGG -3'
(R):5'- TGAAACTGAATTCCAAACTTCCG -3'
Posted On2014-06-30