Incidental Mutation 'R1868:Ubr5'
ID209000
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
MMRRC Submission 039890-MU
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1868 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38041846 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 169 (S169T)
Ref Sequence ENSEMBL: ENSMUSP00000105965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect probably benign
Transcript: ENSMUST00000110336
AA Change: S169T

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: S169T

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226414
AA Change: S169T

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (115/118)
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A T 5: 66,000,217 M1K probably null Het
9330182L06Rik T A 5: 9,479,251 I1028K probably damaging Het
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
A630073D07Rik C T 6: 132,626,494 E100K unknown Het
Abcc3 T G 11: 94,364,063 D638A probably benign Het
Acadm T C 3: 153,930,252 I272V probably benign Het
Adam2 G A 14: 66,077,658 T22I probably damaging Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Arfgef3 A T 10: 18,661,387 I182K probably benign Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Brca1 T A 11: 101,498,013 H1675L probably benign Het
Btd G T 14: 31,667,309 G329V probably benign Het
Capsl T A 15: 9,461,830 L104* probably null Het
Cbx1 T C 11: 96,802,728 S107P probably benign Het
Cd207 G T 6: 83,671,701 Y326* probably null Het
Cenpp T C 13: 49,641,283 D136G probably damaging Het
Chsy3 A G 18: 59,176,488 probably null Het
Cntrl T A 2: 35,129,815 H551Q probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Cybrd1 T A 2: 71,137,634 F183Y possibly damaging Het
D5Ertd577e T A 5: 95,482,899 Y212N probably benign Het
D5Ertd579e G A 5: 36,616,427 S208L probably damaging Het
Dlg2 A T 7: 92,386,952 K719* probably null Het
Dppa1 A T 11: 46,625,566 probably null Het
Dse A G 10: 34,153,288 V602A possibly damaging Het
Elmo1 C T 13: 20,589,653 A611V possibly damaging Het
Ets2 T C 16: 95,715,074 S233P probably benign Het
Fam129a A G 1: 151,641,551 S104G possibly damaging Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam198a A G 9: 121,965,427 T216A possibly damaging Het
Fchsd2 G A 7: 101,250,438 probably benign Het
Fkbp4 T C 6: 128,432,490 R402G probably benign Het
G2e3 T A 12: 51,353,629 D21E probably benign Het
Gck A T 11: 5,902,165 N391K probably damaging Het
Gm11077 T A 6: 140,729,291 I3N unknown Het
Gm13762 T C 2: 88,973,784 T36A possibly damaging Het
Gm6793 T C 8: 112,014,456 M185V probably benign Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Hat1 T A 2: 71,421,283 Y225* probably null Het
Iars2 A T 1: 185,318,568 D441E probably benign Het
Ido2 C A 8: 24,553,760 M92I possibly damaging Het
Ifne T C 4: 88,879,671 E170G probably damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Intu G T 3: 40,664,335 G257V probably damaging Het
Jakmip3 A G 7: 139,007,587 K140R probably benign Het
Kcnip3 T C 2: 127,459,343 E237G probably damaging Het
Ksr2 A C 5: 117,505,529 E121A probably benign Het
Lars T A 18: 42,214,837 I974F probably benign Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lhfpl4 T A 6: 113,176,433 D125V probably benign Het
Luc7l G A 17: 26,280,056 probably benign Het
Mei1 T C 15: 82,124,953 L833P probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Muc4 C T 16: 32,756,341 R2072C unknown Het
Myh3 A G 11: 67,085,026 K295E probably benign Het
Ndufaf5 A G 2: 140,181,589 I115V probably benign Het
Neb T C 2: 52,326,744 K140E probably damaging Het
Npas2 A G 1: 39,300,678 D103G probably benign Het
Ntrk3 A T 7: 78,192,604 H825Q possibly damaging Het
Nup62 T A 7: 44,829,048 S162R possibly damaging Het
Olfr1000 T A 2: 85,608,065 I282F probably damaging Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr143 A G 9: 38,253,690 E91G probably damaging Het
Orc4 A G 2: 48,910,293 M281T probably benign Het
Osbpl5 C A 7: 143,715,773 R22L probably damaging Het
Otos A G 1: 92,644,463 F47S probably damaging Het
Parp11 A G 6: 127,470,777 T25A probably damaging Het
Pcdhb9 A C 18: 37,402,084 D377A probably damaging Het
Pdgfra C T 5: 75,170,873 S348L probably benign Het
Pdlim5 C A 3: 142,306,299 probably null Het
Peg12 T C 7: 62,463,668 H227R probably benign Het
Piezo2 T C 18: 63,019,344 E2559G probably damaging Het
Pnisr C T 4: 21,874,086 probably benign Het
Ppa2 A T 3: 133,348,097 I183F probably damaging Het
Prl2a1 T C 13: 27,804,940 L16P probably damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rbm34 C A 8: 126,970,881 A27S probably benign Het
Rchy1 T C 5: 91,951,903 D192G probably damaging Het
Rexo1 T C 10: 80,542,920 D1094G probably damaging Het
Rtl1 T A 12: 109,590,536 D1623V probably damaging Het
Ryr2 C T 13: 11,731,700 E1989K probably benign Het
Sema6c A G 3: 95,170,813 E500G probably damaging Het
Slc13a1 T A 6: 24,118,000 Y246F probably damaging Het
Slc39a9 C T 12: 80,679,523 L249F probably damaging Het
Slc6a21 C T 7: 45,287,828 P261S probably benign Het
Slco2b1 C T 7: 99,686,036 C179Y probably damaging Het
Sox6 T C 7: 115,659,538 N252S possibly damaging Het
Spr-ps1 C T 6: 85,155,903 noncoding transcript Het
Sptbn1 C A 11: 30,114,781 R1906L possibly damaging Het
Stac2 T C 11: 98,052,945 D13G probably benign Het
Stat5a G T 11: 100,874,129 R226L probably damaging Het
Suz12 A G 11: 80,013,599 probably null Het
Tas2r144 C A 6: 42,216,002 H225Q probably benign Het
Tdo2 T A 3: 81,960,546 M331L probably benign Het
Tesk1 T C 4: 43,447,201 W530R probably damaging Het
Tlr6 T C 5: 64,954,829 N245S probably benign Het
Tnfrsf11a G T 1: 105,844,705 A573S probably damaging Het
Tpbpb A T 13: 60,902,530 probably benign Het
Trim24 T A 6: 37,951,512 S590T probably damaging Het
Ttll3 G T 6: 113,392,764 A90S possibly damaging Het
Usp28 T C 9: 49,016,707 V363A probably damaging Het
Vcan A G 13: 89,690,871 S2185P probably benign Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r3 G A 3: 64,259,116 P865S probably damaging Het
Wapl A G 14: 34,692,458 T426A probably benign Het
Wdr37 G T 13: 8,836,851 T300K probably damaging Het
Wrap53 A T 11: 69,562,164 V439E probably null Het
Wrn A G 8: 33,257,221 S868P probably benign Het
Zfhx4 A G 3: 5,412,714 E3463G probably damaging Het
Zfp189 T A 4: 49,529,283 C129S possibly damaging Het
Zfp442 T C 2: 150,408,180 K544E probably damaging Het
Zfp939 T A 7: 39,473,304 noncoding transcript Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCTTGTAGAACAACTTGTG -3'
(R):5'- GTATGCAGATATTCAACAAAGGTGG -3'

Sequencing Primer
(F):5'- CCTGAAGTCTTCTAAGTTGGTAAAC -3'
(R):5'- TGTACAAGAATGAGACTCAAAATGAC -3'
Posted On2014-06-30