Incidental Mutation 'R1868:9930021J03Rik'
ID209012
Institutional Source Beutler Lab
Gene Symbol 9930021J03Rik
Ensembl Gene ENSMUSG00000046138
Gene NameRIKEN cDNA 9930021J03 gene
SynonymsGm9832
MMRRC Submission 039890-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R1868 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location29714402-29805989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29743598 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 743 (S743T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177155]
Predicted Effect probably damaging
Transcript: ENSMUST00000059484
AA Change: S743T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054060
Gene: ENSMUSG00000046138
AA Change: S743T

DomainStartEndE-ValueType
low complexity region 4 66 N/A INTRINSIC
BROMO 75 198 1.22e-3 SMART
low complexity region 225 235 N/A INTRINSIC
coiled coil region 248 289 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
low complexity region 495 508 N/A INTRINSIC
coiled coil region 673 705 N/A INTRINSIC
low complexity region 722 756 N/A INTRINSIC
coiled coil region 764 796 N/A INTRINSIC
low complexity region 1146 1160 N/A INTRINSIC
internal_repeat_1 1164 1293 9.57e-8 PROSPERO
low complexity region 1295 1304 N/A INTRINSIC
low complexity region 1386 1415 N/A INTRINSIC
low complexity region 1468 1483 N/A INTRINSIC
low complexity region 1602 1624 N/A INTRINSIC
low complexity region 1647 1663 N/A INTRINSIC
low complexity region 1732 1745 N/A INTRINSIC
internal_repeat_1 1766 1910 9.57e-8 PROSPERO
low complexity region 1987 1993 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2053 2071 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000175726
AA Change: S620T
Predicted Effect unknown
Transcript: ENSMUST00000175764
AA Change: S5T
SMART Domains Protein: ENSMUSP00000135031
Gene: ENSMUSG00000046138
AA Change: S5T

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 379 393 N/A INTRINSIC
internal_repeat_1 397 526 2.65e-5 PROSPERO
low complexity region 528 537 N/A INTRINSIC
low complexity region 619 648 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 835 857 N/A INTRINSIC
low complexity region 880 896 N/A INTRINSIC
low complexity region 965 978 N/A INTRINSIC
internal_repeat_1 999 1143 2.65e-5 PROSPERO
low complexity region 1220 1226 N/A INTRINSIC
low complexity region 1246 1260 N/A INTRINSIC
low complexity region 1286 1304 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176773
AA Change: S26T
Predicted Effect probably benign
Transcript: ENSMUST00000177155
AA Change: S676T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135473
Gene: ENSMUSG00000046138
AA Change: S676T

DomainStartEndE-ValueType
low complexity region 4 66 N/A INTRINSIC
BROMO 75 198 1.22e-3 SMART
low complexity region 205 219 N/A INTRINSIC
low complexity region 280 298 N/A INTRINSIC
low complexity region 428 441 N/A INTRINSIC
coiled coil region 606 638 N/A INTRINSIC
low complexity region 655 689 N/A INTRINSIC
coiled coil region 697 729 N/A INTRINSIC
low complexity region 1079 1093 N/A INTRINSIC
internal_repeat_1 1097 1226 1.32e-7 PROSPERO
low complexity region 1228 1237 N/A INTRINSIC
low complexity region 1319 1348 N/A INTRINSIC
low complexity region 1401 1416 N/A INTRINSIC
low complexity region 1535 1557 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
low complexity region 1665 1678 N/A INTRINSIC
internal_repeat_1 1699 1843 1.32e-7 PROSPERO
low complexity region 1920 1926 N/A INTRINSIC
low complexity region 1946 1960 N/A INTRINSIC
low complexity region 1986 2004 N/A INTRINSIC
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (115/118)
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A T 5: 66,000,217 M1K probably null Het
9330182L06Rik T A 5: 9,479,251 I1028K probably damaging Het
A630073D07Rik C T 6: 132,626,494 E100K unknown Het
Abcc3 T G 11: 94,364,063 D638A probably benign Het
Acadm T C 3: 153,930,252 I272V probably benign Het
Adam2 G A 14: 66,077,658 T22I probably damaging Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Arfgef3 A T 10: 18,661,387 I182K probably benign Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Brca1 T A 11: 101,498,013 H1675L probably benign Het
Btd G T 14: 31,667,309 G329V probably benign Het
Capsl T A 15: 9,461,830 L104* probably null Het
Cbx1 T C 11: 96,802,728 S107P probably benign Het
Cd207 G T 6: 83,671,701 Y326* probably null Het
Cenpp T C 13: 49,641,283 D136G probably damaging Het
Chsy3 A G 18: 59,176,488 probably null Het
Cntrl T A 2: 35,129,815 H551Q probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Cybrd1 T A 2: 71,137,634 F183Y possibly damaging Het
D5Ertd577e T A 5: 95,482,899 Y212N probably benign Het
D5Ertd579e G A 5: 36,616,427 S208L probably damaging Het
Dlg2 A T 7: 92,386,952 K719* probably null Het
Dppa1 A T 11: 46,625,566 probably null Het
Dse A G 10: 34,153,288 V602A possibly damaging Het
Elmo1 C T 13: 20,589,653 A611V possibly damaging Het
Ets2 T C 16: 95,715,074 S233P probably benign Het
Fam129a A G 1: 151,641,551 S104G possibly damaging Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam198a A G 9: 121,965,427 T216A possibly damaging Het
Fchsd2 G A 7: 101,250,438 probably benign Het
Fkbp4 T C 6: 128,432,490 R402G probably benign Het
G2e3 T A 12: 51,353,629 D21E probably benign Het
Gck A T 11: 5,902,165 N391K probably damaging Het
Gm11077 T A 6: 140,729,291 I3N unknown Het
Gm13762 T C 2: 88,973,784 T36A possibly damaging Het
Gm6793 T C 8: 112,014,456 M185V probably benign Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Hat1 T A 2: 71,421,283 Y225* probably null Het
Iars2 A T 1: 185,318,568 D441E probably benign Het
Ido2 C A 8: 24,553,760 M92I possibly damaging Het
Ifne T C 4: 88,879,671 E170G probably damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Intu G T 3: 40,664,335 G257V probably damaging Het
Jakmip3 A G 7: 139,007,587 K140R probably benign Het
Kcnip3 T C 2: 127,459,343 E237G probably damaging Het
Ksr2 A C 5: 117,505,529 E121A probably benign Het
Lars T A 18: 42,214,837 I974F probably benign Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lhfpl4 T A 6: 113,176,433 D125V probably benign Het
Luc7l G A 17: 26,280,056 probably benign Het
Mei1 T C 15: 82,124,953 L833P probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Muc4 C T 16: 32,756,341 R2072C unknown Het
Myh3 A G 11: 67,085,026 K295E probably benign Het
Ndufaf5 A G 2: 140,181,589 I115V probably benign Het
Neb T C 2: 52,326,744 K140E probably damaging Het
Npas2 A G 1: 39,300,678 D103G probably benign Het
Ntrk3 A T 7: 78,192,604 H825Q possibly damaging Het
Nup62 T A 7: 44,829,048 S162R possibly damaging Het
Olfr1000 T A 2: 85,608,065 I282F probably damaging Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr143 A G 9: 38,253,690 E91G probably damaging Het
Orc4 A G 2: 48,910,293 M281T probably benign Het
Osbpl5 C A 7: 143,715,773 R22L probably damaging Het
Otos A G 1: 92,644,463 F47S probably damaging Het
Parp11 A G 6: 127,470,777 T25A probably damaging Het
Pcdhb9 A C 18: 37,402,084 D377A probably damaging Het
Pdgfra C T 5: 75,170,873 S348L probably benign Het
Pdlim5 C A 3: 142,306,299 probably null Het
Peg12 T C 7: 62,463,668 H227R probably benign Het
Piezo2 T C 18: 63,019,344 E2559G probably damaging Het
Pnisr C T 4: 21,874,086 probably benign Het
Ppa2 A T 3: 133,348,097 I183F probably damaging Het
Prl2a1 T C 13: 27,804,940 L16P probably damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rbm34 C A 8: 126,970,881 A27S probably benign Het
Rchy1 T C 5: 91,951,903 D192G probably damaging Het
Rexo1 T C 10: 80,542,920 D1094G probably damaging Het
Rtl1 T A 12: 109,590,536 D1623V probably damaging Het
Ryr2 C T 13: 11,731,700 E1989K probably benign Het
Sema6c A G 3: 95,170,813 E500G probably damaging Het
Slc13a1 T A 6: 24,118,000 Y246F probably damaging Het
Slc39a9 C T 12: 80,679,523 L249F probably damaging Het
Slc6a21 C T 7: 45,287,828 P261S probably benign Het
Slco2b1 C T 7: 99,686,036 C179Y probably damaging Het
Sox6 T C 7: 115,659,538 N252S possibly damaging Het
Spr-ps1 C T 6: 85,155,903 noncoding transcript Het
Sptbn1 C A 11: 30,114,781 R1906L possibly damaging Het
Stac2 T C 11: 98,052,945 D13G probably benign Het
Stat5a G T 11: 100,874,129 R226L probably damaging Het
Suz12 A G 11: 80,013,599 probably null Het
Tas2r144 C A 6: 42,216,002 H225Q probably benign Het
Tdo2 T A 3: 81,960,546 M331L probably benign Het
Tesk1 T C 4: 43,447,201 W530R probably damaging Het
Tlr6 T C 5: 64,954,829 N245S probably benign Het
Tnfrsf11a G T 1: 105,844,705 A573S probably damaging Het
Tpbpb A T 13: 60,902,530 probably benign Het
Trim24 T A 6: 37,951,512 S590T probably damaging Het
Ttll3 G T 6: 113,392,764 A90S possibly damaging Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp28 T C 9: 49,016,707 V363A probably damaging Het
Vcan A G 13: 89,690,871 S2185P probably benign Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r3 G A 3: 64,259,116 P865S probably damaging Het
Wapl A G 14: 34,692,458 T426A probably benign Het
Wdr37 G T 13: 8,836,851 T300K probably damaging Het
Wrap53 A T 11: 69,562,164 V439E probably null Het
Wrn A G 8: 33,257,221 S868P probably benign Het
Zfhx4 A G 3: 5,412,714 E3463G probably damaging Het
Zfp189 T A 4: 49,529,283 C129S possibly damaging Het
Zfp442 T C 2: 150,408,180 K544E probably damaging Het
Zfp939 T A 7: 39,473,304 noncoding transcript Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in 9930021J03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:9930021J03Rik APN 19 29754020 missense probably benign 0.33
IGL01535:9930021J03Rik APN 19 29753812 missense possibly damaging 0.53
IGL02019:9930021J03Rik APN 19 29717063 missense probably benign 0.28
IGL02034:9930021J03Rik APN 19 29716859 missense possibly damaging 0.73
IGL03114:9930021J03Rik APN 19 29717132 missense probably benign 0.18
IGL03382:9930021J03Rik APN 19 29717276 missense probably damaging 1.00
R0020:9930021J03Rik UTSW 19 29716197 missense probably damaging 0.98
R0020:9930021J03Rik UTSW 19 29716197 missense probably damaging 0.98
R0142:9930021J03Rik UTSW 19 29718254 missense possibly damaging 0.93
R0178:9930021J03Rik UTSW 19 29754788 missense probably damaging 1.00
R0453:9930021J03Rik UTSW 19 29753668 missense probably damaging 1.00
R0730:9930021J03Rik UTSW 19 29717981 missense probably benign 0.00
R0735:9930021J03Rik UTSW 19 29717638 missense possibly damaging 0.92
R0891:9930021J03Rik UTSW 19 29717653 missense probably damaging 1.00
R0894:9930021J03Rik UTSW 19 29720574 splice site probably benign
R1289:9930021J03Rik UTSW 19 29723452 missense probably benign 0.07
R1368:9930021J03Rik UTSW 19 29716396 missense probably damaging 0.97
R1387:9930021J03Rik UTSW 19 29723453 missense probably benign 0.15
R1483:9930021J03Rik UTSW 19 29719345 missense possibly damaging 0.93
R1526:9930021J03Rik UTSW 19 29735145 missense probably damaging 1.00
R1612:9930021J03Rik UTSW 19 29717845 missense possibly damaging 0.86
R1721:9930021J03Rik UTSW 19 29743598 missense probably damaging 0.99
R1764:9930021J03Rik UTSW 19 29719160 missense possibly damaging 0.53
R1822:9930021J03Rik UTSW 19 29716414 missense probably damaging 0.99
R1824:9930021J03Rik UTSW 19 29716414 missense probably damaging 0.99
R1859:9930021J03Rik UTSW 19 29754923 missense possibly damaging 0.53
R1880:9930021J03Rik UTSW 19 29718123 missense probably benign 0.06
R1898:9930021J03Rik UTSW 19 29735132 missense possibly damaging 0.74
R1936:9930021J03Rik UTSW 19 29753677 missense possibly damaging 0.87
R1939:9930021J03Rik UTSW 19 29753677 missense possibly damaging 0.87
R1969:9930021J03Rik UTSW 19 29716675 missense possibly damaging 0.95
R2153:9930021J03Rik UTSW 19 29716829 missense probably benign 0.01
R2366:9930021J03Rik UTSW 19 29753635 missense probably damaging 0.99
R2379:9930021J03Rik UTSW 19 29718875 missense probably benign 0.01
R3107:9930021J03Rik UTSW 19 29723447 missense probably damaging 1.00
R4012:9930021J03Rik UTSW 19 29743590 missense probably damaging 1.00
R4222:9930021J03Rik UTSW 19 29718749 missense probably benign 0.18
R4328:9930021J03Rik UTSW 19 29743561 missense probably benign 0.00
R4329:9930021J03Rik UTSW 19 29743561 missense probably benign 0.00
R4387:9930021J03Rik UTSW 19 29805315 unclassified probably benign
R4688:9930021J03Rik UTSW 19 29717101 missense probably benign 0.33
R4796:9930021J03Rik UTSW 19 29753618 missense probably benign 0.33
R4820:9930021J03Rik UTSW 19 29718409 missense possibly damaging 0.53
R4832:9930021J03Rik UTSW 19 29717216 missense possibly damaging 0.53
R5056:9930021J03Rik UTSW 19 29717359 missense probably benign
R5150:9930021J03Rik UTSW 19 29805550 missense probably damaging 0.96
R5224:9930021J03Rik UTSW 19 29719050 missense possibly damaging 0.73
R5306:9930021J03Rik UTSW 19 29729830 intron probably benign
R5460:9930021J03Rik UTSW 19 29754850 missense probably damaging 0.98
R5477:9930021J03Rik UTSW 19 29754118 missense probably benign 0.33
R5531:9930021J03Rik UTSW 19 29753672 missense possibly damaging 0.73
R5559:9930021J03Rik UTSW 19 29716963 missense possibly damaging 0.91
R5647:9930021J03Rik UTSW 19 29753810 missense possibly damaging 0.73
R5886:9930021J03Rik UTSW 19 29719277 missense probably benign 0.03
R6029:9930021J03Rik UTSW 19 29754967 unclassified probably benign
R6240:9930021J03Rik UTSW 19 29717240 missense probably benign 0.18
R6331:9930021J03Rik UTSW 19 29717747 missense probably benign 0.33
R6456:9930021J03Rik UTSW 19 29716514 missense possibly damaging 0.93
R6584:9930021J03Rik UTSW 19 29718728 missense possibly damaging 0.53
R6661:9930021J03Rik UTSW 19 29723464 missense possibly damaging 0.53
R6991:9930021J03Rik UTSW 19 29719108 missense possibly damaging 0.86
R7059:9930021J03Rik UTSW 19 29719545 missense probably benign 0.33
R7128:9930021J03Rik UTSW 19 29716481 missense possibly damaging 0.53
R7211:9930021J03Rik UTSW 19 29786312 missense
X0027:9930021J03Rik UTSW 19 29735199 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTAGGAATACATGCAAACGGAC -3'
(R):5'- CATTTGCTTTCACTGAGGCTTG -3'

Sequencing Primer
(F):5'- GGAATACATGCAAACGGACATAAAG -3'
(R):5'- CACTGAGGCTTGTTTGATTCATG -3'
Posted On2014-06-30