Incidental Mutation 'R1880:Itga11'
ID209046
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
Synonyms
MMRRC Submission 039901-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1880 (G1)
Quality Score159
Status Not validated
Chromosome9
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62677949 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect probably benign
Transcript: ENSMUST00000034774
AA Change: D2G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: D2G

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159012
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik C A 19: 29,718,123 L1323F probably benign Het
Afdn A G 17: 13,852,353 D846G possibly damaging Het
Arhgef5 C A 6: 43,273,088 Q258K possibly damaging Het
Atp10b G T 11: 43,259,432 G1319V probably damaging Het
Axl T C 7: 25,774,548 T315A probably damaging Het
Btnl2 A G 17: 34,365,363 E420G possibly damaging Het
Capn2 A G 1: 182,489,016 W293R probably damaging Het
Cd209f A G 8: 4,105,464 probably null Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Col1a1 A G 11: 94,950,568 K1259R unknown Het
Dpysl3 A T 18: 43,329,874 probably null Het
Dus4l T C 12: 31,640,870 I261V probably benign Het
Ell3 T C 2: 121,440,311 D247G probably benign Het
Erg G A 16: 95,377,309 T246I probably benign Het
Eva1c T C 16: 90,897,415 I196T possibly damaging Het
Fbxo43 T C 15: 36,162,515 D182G probably benign Het
Frrs1 T C 3: 116,896,795 probably null Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gata4 G T 14: 63,204,695 P20Q probably damaging Het
Gm15448 C T 7: 3,824,951 probably null Het
Gmnc T C 16: 26,965,611 D48G probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Habp2 A G 19: 56,317,828 I481V possibly damaging Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Hnrnpul1 A G 7: 25,733,098 V380A possibly damaging Het
Hspa2 G A 12: 76,405,920 D463N possibly damaging Het
Kel G A 6: 41,687,545 L653F possibly damaging Het
Lgr5 T C 10: 115,452,279 Y748C probably damaging Het
Lpxn A G 19: 12,804,088 K57E probably benign Het
Ltbp2 G T 12: 84,829,271 H501N probably benign Het
Macf1 G A 4: 123,438,591 A2419V probably damaging Het
Map3k12 A G 15: 102,502,064 probably null Het
Megf8 G A 7: 25,334,860 V668I possibly damaging Het
Mmp10 T C 9: 7,505,574 S280P probably benign Het
Neb C A 2: 52,258,731 M2601I probably damaging Het
Nsd1 T A 13: 55,213,793 N191K probably damaging Het
Olfr1137 C A 2: 87,711,295 G204C probably damaging Het
Olfr263 A T 13: 21,133,632 N286Y probably damaging Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr807 A G 10: 129,755,421 F10L probably benign Het
Patj C T 4: 98,497,240 P364S probably benign Het
Pex1 T C 5: 3,605,770 V39A probably benign Het
Pkhd1l1 A T 15: 44,525,242 I1332F probably benign Het
Polq T C 16: 37,086,592 V2026A possibly damaging Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Ppp4r4 T A 12: 103,605,035 Y678N possibly damaging Het
Rpf2 T C 10: 40,233,158 D95G possibly damaging Het
Sema3c A T 5: 17,727,466 K656* probably null Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Snap25 G A 2: 136,777,385 V153M probably damaging Het
Snrnp70 T C 7: 45,377,362 probably null Het
Tas2r144 C T 6: 42,216,070 T248I probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Usp38 T C 8: 81,001,066 E346G probably damaging Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r91 A T 7: 20,101,773 S206C probably damaging Het
Vps36 T C 8: 22,213,562 probably null Het
Wdfy3 T C 5: 101,917,435 N1289S probably benign Het
Zfp759 T C 13: 67,139,212 C276R probably damaging Het
Zkscan17 G A 11: 59,487,629 Q243* probably null Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R0924:Itga11 UTSW 9 62776674 missense probably benign 0.14
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1934:Itga11 UTSW 9 62744514 missense probably damaging 1.00
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3158:Itga11 UTSW 9 62769278 missense probably benign 0.02
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4909:Itga11 UTSW 9 62755299 missense probably damaging 1.00
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4957:Itga11 UTSW 9 62767648 missense probably benign 0.00
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R5996:Itga11 UTSW 9 62755673 missense probably benign 0.01
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7264:Itga11 UTSW 9 62745908 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATTCTCTGCTATGACCCTGAGG -3'
(R):5'- TGTGTCCCCAAGTGCTACTG -3'

Sequencing Primer
(F):5'- ATACTGGCGAGGGCGTC -3'
(R):5'- TCCCCAAGTGCTACTGAAGGAG -3'
Posted On2014-06-30