Incidental Mutation 'R1880:Col1a1'
ID209054
Institutional Source Beutler Lab
Gene Symbol Col1a1
Ensembl Gene ENSMUSG00000001506
Gene Namecollagen, type I, alpha 1
SynonymsCola1, Mov-13, Col1a-1, Cola-1
MMRRC Submission 039901-MU
Accession Numbers

MGI: 88467

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1880 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location94936224-94953042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94950568 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1259 (K1259R)
Ref Sequence ENSEMBL: ENSMUSP00000001547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001547]
Predicted Effect unknown
Transcript: ENSMUST00000001547
AA Change: K1259R
SMART Domains Protein: ENSMUSP00000001547
Gene: ENSMUSG00000001506
AA Change: K1259R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWC 31 86 1.04e-16 SMART
Pfam:Collagen 97 154 1.1e-9 PFAM
Pfam:Collagen 166 227 7e-10 PFAM
Pfam:Collagen 225 284 2.4e-13 PFAM
Pfam:Collagen 285 344 5.9e-12 PFAM
low complexity region 354 426 N/A INTRINSIC
internal_repeat_4 427 444 4.93e-7 PROSPERO
low complexity region 447 486 N/A INTRINSIC
low complexity region 495 516 N/A INTRINSIC
low complexity region 527 567 N/A INTRINSIC
internal_repeat_3 570 588 1.25e-9 PROSPERO
low complexity region 590 600 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 629 651 N/A INTRINSIC
internal_repeat_1 652 675 6.29e-11 PROSPERO
internal_repeat_4 658 675 4.93e-7 PROSPERO
low complexity region 678 699 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
internal_repeat_2 718 738 2.08e-10 PROSPERO
internal_repeat_1 718 741 6.29e-11 PROSPERO
internal_repeat_3 726 744 1.25e-9 PROSPERO
internal_repeat_5 737 752 9.8e-6 PROSPERO
Pfam:Collagen 768 827 2.8e-12 PFAM
Pfam:Collagen 828 887 6.8e-11 PFAM
internal_repeat_5 944 959 9.8e-6 PROSPERO
internal_repeat_2 952 972 2.08e-10 PROSPERO
Pfam:Collagen 1008 1077 4.8e-8 PFAM
Pfam:Collagen 1068 1127 1.2e-12 PFAM
Pfam:Collagen 1122 1184 2.8e-9 PFAM
PDB:3HR2|C 1185 1205 6e-6 PDB
COLFI 1217 1453 2.04e-162 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148046
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-2 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice lacking the encoded protein die in utero caused by the rupture of a major blood vessel. Transgenic mice expressing significantly lower levels of this gene exhibit morphological and functional defects in mineralized and non-mineralized connective tissue and, progressive loss of hearing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutations in this locus cause variable phenotype, from embryonic lethal to viable/fertile with altered fibrillogenesis. Homozygotes can show impaired bone formation and fragility, osteoporosis, dermal fibrosis, impaired uterine postpartum involution, andaortic dissection. [provided by MGI curators]
Allele List at MGI

All alleles(46) : Targeted(40) Gene trapped(3) Transgenic(1) Chemically induced(2)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik C A 19: 29,718,123 L1323F probably benign Het
Afdn A G 17: 13,852,353 D846G possibly damaging Het
Arhgef5 C A 6: 43,273,088 Q258K possibly damaging Het
Atp10b G T 11: 43,259,432 G1319V probably damaging Het
Axl T C 7: 25,774,548 T315A probably damaging Het
Btnl2 A G 17: 34,365,363 E420G possibly damaging Het
Capn2 A G 1: 182,489,016 W293R probably damaging Het
Cd209f A G 8: 4,105,464 probably null Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Dpysl3 A T 18: 43,329,874 probably null Het
Dus4l T C 12: 31,640,870 I261V probably benign Het
Ell3 T C 2: 121,440,311 D247G probably benign Het
Erg G A 16: 95,377,309 T246I probably benign Het
Eva1c T C 16: 90,897,415 I196T possibly damaging Het
Fbxo43 T C 15: 36,162,515 D182G probably benign Het
Frrs1 T C 3: 116,896,795 probably null Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gata4 G T 14: 63,204,695 P20Q probably damaging Het
Gm15448 C T 7: 3,824,951 probably null Het
Gmnc T C 16: 26,965,611 D48G probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Habp2 A G 19: 56,317,828 I481V possibly damaging Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Hnrnpul1 A G 7: 25,733,098 V380A possibly damaging Het
Hspa2 G A 12: 76,405,920 D463N possibly damaging Het
Itga11 A G 9: 62,677,949 D2G probably benign Het
Kel G A 6: 41,687,545 L653F possibly damaging Het
Lgr5 T C 10: 115,452,279 Y748C probably damaging Het
Lpxn A G 19: 12,804,088 K57E probably benign Het
Ltbp2 G T 12: 84,829,271 H501N probably benign Het
Macf1 G A 4: 123,438,591 A2419V probably damaging Het
Map3k12 A G 15: 102,502,064 probably null Het
Megf8 G A 7: 25,334,860 V668I possibly damaging Het
Mmp10 T C 9: 7,505,574 S280P probably benign Het
Neb C A 2: 52,258,731 M2601I probably damaging Het
Nsd1 T A 13: 55,213,793 N191K probably damaging Het
Olfr1137 C A 2: 87,711,295 G204C probably damaging Het
Olfr263 A T 13: 21,133,632 N286Y probably damaging Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr807 A G 10: 129,755,421 F10L probably benign Het
Patj C T 4: 98,497,240 P364S probably benign Het
Pex1 T C 5: 3,605,770 V39A probably benign Het
Pkhd1l1 A T 15: 44,525,242 I1332F probably benign Het
Polq T C 16: 37,086,592 V2026A possibly damaging Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Ppp4r4 T A 12: 103,605,035 Y678N possibly damaging Het
Rpf2 T C 10: 40,233,158 D95G possibly damaging Het
Sema3c A T 5: 17,727,466 K656* probably null Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Snap25 G A 2: 136,777,385 V153M probably damaging Het
Snrnp70 T C 7: 45,377,362 probably null Het
Tas2r144 C T 6: 42,216,070 T248I probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Usp38 T C 8: 81,001,066 E346G probably damaging Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r91 A T 7: 20,101,773 S206C probably damaging Het
Vps36 T C 8: 22,213,562 probably null Het
Wdfy3 T C 5: 101,917,435 N1289S probably benign Het
Zfp759 T C 13: 67,139,212 C276R probably damaging Het
Zkscan17 G A 11: 59,487,629 Q243* probably null Het
Other mutations in Col1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col1a1 APN 11 94949378 missense unknown
IGL01383:Col1a1 APN 11 94945525 missense probably damaging 1.00
IGL01717:Col1a1 APN 11 94950777 missense unknown
IGL02889:Col1a1 APN 11 94951509 missense unknown
seal UTSW 11 94947184 splice site probably benign
walrus UTSW 11 94942385 missense unknown
R0121:Col1a1 UTSW 11 94938069 missense unknown
R0400:Col1a1 UTSW 11 94941369 splice site probably benign
R0545:Col1a1 UTSW 11 94951594 missense unknown
R0661:Col1a1 UTSW 11 94949389 missense unknown
R1220:Col1a1 UTSW 11 94951131 missense unknown
R1717:Col1a1 UTSW 11 94948392 missense unknown
R1732:Col1a1 UTSW 11 94944415 splice site probably benign
R1879:Col1a1 UTSW 11 94951225 missense unknown
R1901:Col1a1 UTSW 11 94946632 splice site probably null
R2113:Col1a1 UTSW 11 94948362 missense unknown
R2386:Col1a1 UTSW 11 94950391 missense unknown
R3803:Col1a1 UTSW 11 94938069 missense unknown
R4839:Col1a1 UTSW 11 94950095 critical splice acceptor site probably null
R4936:Col1a1 UTSW 11 94947132 missense unknown
R5081:Col1a1 UTSW 11 94951576 missense unknown
R5105:Col1a1 UTSW 11 94942385 missense unknown
R5110:Col1a1 UTSW 11 94941593 critical splice donor site probably null
R5247:Col1a1 UTSW 11 94947187 splice site probably null
R5773:Col1a1 UTSW 11 94939429 missense probably benign 0.10
R5776:Col1a1 UTSW 11 94949724 missense unknown
R5991:Col1a1 UTSW 11 94937919 missense unknown
R6415:Col1a1 UTSW 11 94940160 missense unknown
R6483:Col1a1 UTSW 11 94942618 splice site probably null
R7207:Col1a1 UTSW 11 94938526 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGGCGGTTATGACTTCAGC -3'
(R):5'- CTTGGTTAGGGTCGATCCAG -3'

Sequencing Primer
(F):5'- TCAAGATGGTGGCCGCTACTAC -3'
(R):5'- AAGCAGCATGGTAGGCTA -3'
Posted On2014-06-30