Incidental Mutation 'R1881:Arsj'
ID209097
Institutional Source Beutler Lab
Gene Symbol Arsj
Ensembl Gene ENSMUSG00000046561
Gene Namearylsulfatase J
Synonyms9330196J05Rik
MMRRC Submission 039902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1881 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location126363684-126440375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126438837 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 411 (S411P)
Ref Sequence ENSEMBL: ENSMUSP00000091511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093976]
Predicted Effect probably damaging
Transcript: ENSMUST00000093976
AA Change: S411P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091511
Gene: ENSMUSG00000046561
AA Change: S411P

DomainStartEndE-ValueType
Pfam:Sulfatase 74 388 8.4e-68 PFAM
low complexity region 554 582 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199285
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfatases (EC 3.1.5.6), such as ARSJ, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,284 D848V probably damaging Het
Acaca C A 11: 84,270,387 Y1026* probably null Het
Acaca T G 11: 84,300,471 probably benign Het
Adcy8 C T 15: 64,806,654 M483I probably damaging Het
Adgrb2 G A 4: 130,010,285 G735S probably damaging Het
Akap9 A G 5: 4,050,173 T2612A probably benign Het
Armc1 A T 3: 19,134,896 S202T possibly damaging Het
Ash1l T C 3: 88,981,555 V247A probably benign Het
Camta2 T C 11: 70,672,016 D935G probably benign Het
Cc2d2a G T 5: 43,740,828 V1626F probably damaging Het
Cpne3 T A 4: 19,535,266 R255S probably benign Het
Cramp1l A G 17: 24,977,682 probably benign Het
Csf2rb2 C T 15: 78,292,535 probably null Het
Cstf3 A T 2: 104,654,218 M396L probably benign Het
Ctnnd2 A G 15: 31,005,081 probably benign Het
Cul7 A T 17: 46,651,962 Y173F probably damaging Het
Dach1 A T 14: 97,901,396 M537K probably benign Het
Ddhd2 T C 8: 25,727,700 I717V probably damaging Het
Dnm1 C T 2: 32,323,730 V475I probably damaging Het
Dnm3 C T 1: 162,477,948 probably benign Het
Dsg1c T A 18: 20,272,540 probably benign Het
Eaf2 A T 16: 36,800,579 probably benign Het
En1 T A 1: 120,603,175 V48E unknown Het
Eral1 T A 11: 78,076,049 H180L possibly damaging Het
Fry T A 5: 150,478,046 C2760S probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ifnl2 T A 7: 28,509,687 R68W probably damaging Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Krtap4-1 C T 11: 99,628,164 G7S probably null Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mup5 C A 4: 61,834,631 E52* probably null Het
Myh15 A G 16: 49,071,083 I189V probably damaging Het
Nav3 T A 10: 109,852,559 Q619L probably damaging Het
Olfr298 T C 7: 86,489,438 M38V probably benign Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr59 A T 11: 74,288,666 T7S probably benign Het
Olfr733 A G 14: 50,299,015 I98T probably damaging Het
Pam T C 1: 97,923,151 T161A probably benign Het
Pigs T C 11: 78,341,756 V472A probably benign Het
Plek A T 11: 16,990,111 N176K probably benign Het
Poc5 A G 13: 96,398,731 N168S probably benign Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Rttn T A 18: 89,015,212 S716T probably damaging Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Slc25a20 G A 9: 108,680,209 probably null Het
Slc5a6 A T 5: 31,036,811 L634Q probably damaging Het
Slfn3 A G 11: 83,213,376 I235V possibly damaging Het
Smarcc1 T A 9: 110,175,099 L407Q probably damaging Het
Spata32 T C 11: 103,210,735 probably benign Het
Tdrd3 A G 14: 87,486,347 probably null Het
Thada A G 17: 84,436,702 V726A probably benign Het
Tmed7 A T 18: 46,588,555 probably null Het
Tmem161a G A 8: 70,180,785 G94S probably null Het
Tmem81 T A 1: 132,508,210 probably benign Het
Trim63 C A 4: 134,316,391 A55E probably damaging Het
Trmt1 A C 8: 84,689,267 probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Tshz3 T C 7: 36,771,654 S1023P possibly damaging Het
Upk3bl G A 5: 136,057,303 R31Q probably benign Het
Usp40 T C 1: 87,994,271 D290G probably benign Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r26 T A 6: 58,008,665 T180S probably benign Het
Wdr48 G T 9: 119,909,540 V89L probably benign Het
Wdr6 G T 9: 108,573,179 probably null Het
Zfp345 A G 2: 150,472,355 Y421H probably damaging Het
Other mutations in Arsj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Arsj APN 3 126364945 missense probably benign 0.00
IGL01150:Arsj APN 3 126438784 missense probably benign
IGL01337:Arsj APN 3 126365114 missense probably damaging 1.00
IGL01446:Arsj APN 3 126438814 missense probably benign 0.01
IGL01484:Arsj APN 3 126365036 missense probably damaging 1.00
IGL02479:Arsj APN 3 126438939 missense possibly damaging 0.91
IGL03149:Arsj APN 3 126439404 utr 3 prime probably benign
R0552:Arsj UTSW 3 126439344 missense probably benign 0.01
R0690:Arsj UTSW 3 126438184 missense probably damaging 0.99
R1809:Arsj UTSW 3 126438295 missense possibly damaging 0.87
R1940:Arsj UTSW 3 126438346 missense probably damaging 1.00
R1957:Arsj UTSW 3 126439021 missense probably benign 0.08
R2156:Arsj UTSW 3 126438688 missense probably damaging 1.00
R2969:Arsj UTSW 3 126439372 missense probably benign 0.01
R3432:Arsj UTSW 3 126364975 missense probably benign 0.00
R4623:Arsj UTSW 3 126364796 missense probably benign 0.00
R4826:Arsj UTSW 3 126438802 missense probably damaging 1.00
R4955:Arsj UTSW 3 126438540 missense probably benign 0.15
R5134:Arsj UTSW 3 126438154 missense probably benign
R5164:Arsj UTSW 3 126438159 missense probably benign 0.00
R5468:Arsj UTSW 3 126438388 missense possibly damaging 0.52
R5664:Arsj UTSW 3 126438657 missense probably damaging 1.00
R6136:Arsj UTSW 3 126364775 start codon destroyed probably null 0.07
X0022:Arsj UTSW 3 126364966 missense possibly damaging 0.52
Z1088:Arsj UTSW 3 126439132 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGTAACTGGCCACTCAGAGG -3'
(R):5'- ATTGCTGAAAGCCTGAGGGG -3'

Sequencing Primer
(F):5'- AGGCATCCGGGCAGTTG -3'
(R):5'- GGGACCCAGTCACTGTAGC -3'
Posted On2014-06-30