Incidental Mutation 'R1881:Cc2d2a'
ID209104
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Namecoiled-coil and C2 domain containing 2A
Synonymsb2b1035Clo, 5730509K17Rik
MMRRC Submission 039902-MU
Accession Numbers

Genbank: NM_172274; MGI: 1924487

Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R1881 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location43662346-43740972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43740828 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1626 (V1626F)
Ref Sequence ENSEMBL: ENSMUSP00000048320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047857] [ENSMUST00000048150] [ENSMUST00000114047] [ENSMUST00000119523] [ENSMUST00000125866] [ENSMUST00000196483]
Predicted Effect probably benign
Transcript: ENSMUST00000047857
SMART Domains Protein: ENSMUSP00000045792
Gene: ENSMUSG00000039753

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 1.3e-10 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 2.43e2 SMART
LRR 382 407 4.87e-4 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 2.45e0 SMART
LRR 624 649 4.65e-1 SMART
Blast:LRR 650 681 2e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000048150
AA Change: V1626F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: V1626F

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114047
SMART Domains Protein: ENSMUSP00000109681
Gene: ENSMUSG00000039753

DomainStartEndE-ValueType
Pfam:Hemerythrin 19 132 4.4e-11 PFAM
FBOX 202 242 2.31e-9 SMART
low complexity region 283 304 N/A INTRINSIC
LRR 349 373 2.43e2 SMART
LRR 376 401 4.87e-4 SMART
low complexity region 475 486 N/A INTRINSIC
LRR 590 615 2.45e0 SMART
LRR 618 643 4.65e-1 SMART
Blast:LRR 644 675 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119523
SMART Domains Protein: ENSMUSP00000113557
Gene: ENSMUSG00000039753

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 121 2.2e-9 PFAM
FBOX 191 231 2.31e-9 SMART
low complexity region 272 293 N/A INTRINSIC
LRR 338 362 2.43e2 SMART
LRR 365 390 4.87e-4 SMART
low complexity region 464 475 N/A INTRINSIC
LRR 579 604 2.45e0 SMART
LRR 607 632 4.65e-1 SMART
Blast:LRR 633 664 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000125866
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141902
SMART Domains Protein: ENSMUSP00000120338
Gene: ENSMUSG00000039753

DomainStartEndE-ValueType
PDB:3V5Z|B 2 82 3e-43 PDB
FBOX 129 169 2.31e-9 SMART
low complexity region 210 231 N/A INTRINSIC
LRR 276 300 2.43e2 SMART
LRR 303 328 4.87e-4 SMART
low complexity region 402 413 N/A INTRINSIC
LRR 517 542 2.45e0 SMART
LRR 545 570 4.65e-1 SMART
Blast:LRR 571 602 3e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196483
SMART Domains Protein: ENSMUSP00000143703
Gene: ENSMUSG00000039753

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 1.3e-10 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 309 N/A INTRINSIC
LRR 354 378 2.43e2 SMART
LRR 381 406 4.87e-4 SMART
low complexity region 480 491 N/A INTRINSIC
LRR 595 620 2.45e0 SMART
LRR 623 648 4.65e-1 SMART
Blast:LRR 649 680 2e-13 BLAST
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,284 D848V probably damaging Het
Acaca C A 11: 84,270,387 Y1026* probably null Het
Acaca T G 11: 84,300,471 probably benign Het
Adcy8 C T 15: 64,806,654 M483I probably damaging Het
Adgrb2 G A 4: 130,010,285 G735S probably damaging Het
Akap9 A G 5: 4,050,173 T2612A probably benign Het
Armc1 A T 3: 19,134,896 S202T possibly damaging Het
Arsj T C 3: 126,438,837 S411P probably damaging Het
Ash1l T C 3: 88,981,555 V247A probably benign Het
Camta2 T C 11: 70,672,016 D935G probably benign Het
Cpne3 T A 4: 19,535,266 R255S probably benign Het
Cramp1l A G 17: 24,977,682 probably benign Het
Csf2rb2 C T 15: 78,292,535 probably null Het
Cstf3 A T 2: 104,654,218 M396L probably benign Het
Ctnnd2 A G 15: 31,005,081 probably benign Het
Cul7 A T 17: 46,651,962 Y173F probably damaging Het
Dach1 A T 14: 97,901,396 M537K probably benign Het
Ddhd2 T C 8: 25,727,700 I717V probably damaging Het
Dnm1 C T 2: 32,323,730 V475I probably damaging Het
Dnm3 C T 1: 162,477,948 probably benign Het
Dsg1c T A 18: 20,272,540 probably benign Het
Eaf2 A T 16: 36,800,579 probably benign Het
En1 T A 1: 120,603,175 V48E unknown Het
Eral1 T A 11: 78,076,049 H180L possibly damaging Het
Fry T A 5: 150,478,046 C2760S probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ifnl2 T A 7: 28,509,687 R68W probably damaging Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Krtap4-1 C T 11: 99,628,164 G7S probably null Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mup5 C A 4: 61,834,631 E52* probably null Het
Myh15 A G 16: 49,071,083 I189V probably damaging Het
Nav3 T A 10: 109,852,559 Q619L probably damaging Het
Olfr298 T C 7: 86,489,438 M38V probably benign Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr59 A T 11: 74,288,666 T7S probably benign Het
Olfr733 A G 14: 50,299,015 I98T probably damaging Het
Pam T C 1: 97,923,151 T161A probably benign Het
Pigs T C 11: 78,341,756 V472A probably benign Het
Plek A T 11: 16,990,111 N176K probably benign Het
Poc5 A G 13: 96,398,731 N168S probably benign Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Rttn T A 18: 89,015,212 S716T probably damaging Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Slc25a20 G A 9: 108,680,209 probably null Het
Slc5a6 A T 5: 31,036,811 L634Q probably damaging Het
Slfn3 A G 11: 83,213,376 I235V possibly damaging Het
Smarcc1 T A 9: 110,175,099 L407Q probably damaging Het
Spata32 T C 11: 103,210,735 probably benign Het
Tdrd3 A G 14: 87,486,347 probably null Het
Thada A G 17: 84,436,702 V726A probably benign Het
Tmed7 A T 18: 46,588,555 probably null Het
Tmem161a G A 8: 70,180,785 G94S probably null Het
Tmem81 T A 1: 132,508,210 probably benign Het
Trim63 C A 4: 134,316,391 A55E probably damaging Het
Trmt1 A C 8: 84,689,267 probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Tshz3 T C 7: 36,771,654 S1023P possibly damaging Het
Upk3bl G A 5: 136,057,303 R31Q probably benign Het
Usp40 T C 1: 87,994,271 D290G probably benign Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r26 T A 6: 58,008,665 T180S probably benign Het
Wdr48 G T 9: 119,909,540 V89L probably benign Het
Wdr6 G T 9: 108,573,179 probably null Het
Zfp345 A G 2: 150,472,355 Y421H probably damaging Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43724380 splice site probably benign
IGL00937:Cc2d2a APN 5 43688122 critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43689003 missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43723784 missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43684185 missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43688969 missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43688237 missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43683115 missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43685248 splice site probably null
IGL02364:Cc2d2a APN 5 43735450 missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43683205 splice site probably benign
IGL02458:Cc2d2a APN 5 43718554 missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43688910 splice site probably benign
IGL02834:Cc2d2a APN 5 43714521 nonsense probably null
IGL02940:Cc2d2a APN 5 43728294 splice site probably null
IGL03003:Cc2d2a APN 5 43671266 missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43732379 missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43735457 splice site probably benign
P0028:Cc2d2a UTSW 5 43684199 missense probably benign
R0193:Cc2d2a UTSW 5 43736118 missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43737512 missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43688266 splice site probably null
R0243:Cc2d2a UTSW 5 43696638 splice site probably benign
R0317:Cc2d2a UTSW 5 43706901 critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43703294 missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43724387 splice site probably benign
R0624:Cc2d2a UTSW 5 43730029 missense probably benign
R0634:Cc2d2a UTSW 5 43681381 splice site probably benign
R1503:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43722470 missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43739371 missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43723688 splice site probably null
R1715:Cc2d2a UTSW 5 43718661 missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43714531 missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43688252 missense probably damaging 1.00
R1917:Cc2d2a UTSW 5 43706222 missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43726373 critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43684033 splice site probably benign
R2244:Cc2d2a UTSW 5 43732433 missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43703888 missense probably benign
R2442:Cc2d2a UTSW 5 43671305 critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43735395 missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43685251 splice site probably null
R3147:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43736109 missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43718714 missense probably benign
R3870:Cc2d2a UTSW 5 43718691 nonsense probably null
R4334:Cc2d2a UTSW 5 43683134 missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43739323 missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43688221 missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43720433 missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43706213 missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43730041 missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43695176 missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43709091 missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43729907 missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43722462 missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43712418 missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43715775 missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43712426 missense probably benign
R5912:Cc2d2a UTSW 5 43720430 missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43729975 missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43668673 missense probably benign
R6142:Cc2d2a UTSW 5 43703198 missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43709113 missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43671235 missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43715776 missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43704074 missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43739412 missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43718677 missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43681331 missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43703215 missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43718585 missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43733929 missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43699979 nonsense probably null
R7071:Cc2d2a UTSW 5 43709113 missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43683139 missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43729990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTCATGATCCTCAAGGC -3'
(R):5'- AGTCAGGTAGTGTCACGAGG -3'

Sequencing Primer
(F):5'- ACAAATATGTTCTTTCTCCTCAGTTC -3'
(R):5'- TAGTGTCACGAGGAGACAGAC -3'
Posted On2014-06-30