Incidental Mutation 'R1881:Fry'
ID209108
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
MMRRC Submission 039902-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R1881 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150478046 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 2760 (C2760S)
Ref Sequence ENSEMBL: ENSMUSP00000084454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204] [ENSMUST00000202566]
Predicted Effect probably damaging
Transcript: ENSMUST00000087204
AA Change: C2760S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: C2760S

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000200863
AA Change: C392S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201196
Predicted Effect possibly damaging
Transcript: ENSMUST00000202566
AA Change: C750S

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144657
Gene: ENSMUSG00000056602
AA Change: C750S

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_C 37 290 1.5e-71 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 447 472 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 832 848 N/A INTRINSIC
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 96% (71/74)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,284 D848V probably damaging Het
Acaca C A 11: 84,270,387 Y1026* probably null Het
Acaca T G 11: 84,300,471 probably benign Het
Adcy8 C T 15: 64,806,654 M483I probably damaging Het
Adgrb2 G A 4: 130,010,285 G735S probably damaging Het
Akap9 A G 5: 4,050,173 T2612A probably benign Het
Armc1 A T 3: 19,134,896 S202T possibly damaging Het
Arsj T C 3: 126,438,837 S411P probably damaging Het
Ash1l T C 3: 88,981,555 V247A probably benign Het
Camta2 T C 11: 70,672,016 D935G probably benign Het
Cc2d2a G T 5: 43,740,828 V1626F probably damaging Het
Cpne3 T A 4: 19,535,266 R255S probably benign Het
Cramp1l A G 17: 24,977,682 probably benign Het
Csf2rb2 C T 15: 78,292,535 probably null Het
Cstf3 A T 2: 104,654,218 M396L probably benign Het
Ctnnd2 A G 15: 31,005,081 probably benign Het
Cul7 A T 17: 46,651,962 Y173F probably damaging Het
Dach1 A T 14: 97,901,396 M537K probably benign Het
Ddhd2 T C 8: 25,727,700 I717V probably damaging Het
Dnm1 C T 2: 32,323,730 V475I probably damaging Het
Dnm3 C T 1: 162,477,948 probably benign Het
Dsg1c T A 18: 20,272,540 probably benign Het
Eaf2 A T 16: 36,800,579 probably benign Het
En1 T A 1: 120,603,175 V48E unknown Het
Eral1 T A 11: 78,076,049 H180L possibly damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ifnl2 T A 7: 28,509,687 R68W probably damaging Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Krtap4-1 C T 11: 99,628,164 G7S probably null Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mup5 C A 4: 61,834,631 E52* probably null Het
Myh15 A G 16: 49,071,083 I189V probably damaging Het
Nav3 T A 10: 109,852,559 Q619L probably damaging Het
Olfr298 T C 7: 86,489,438 M38V probably benign Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr59 A T 11: 74,288,666 T7S probably benign Het
Olfr733 A G 14: 50,299,015 I98T probably damaging Het
Pam T C 1: 97,923,151 T161A probably benign Het
Pigs T C 11: 78,341,756 V472A probably benign Het
Plek A T 11: 16,990,111 N176K probably benign Het
Poc5 A G 13: 96,398,731 N168S probably benign Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Rttn T A 18: 89,015,212 S716T probably damaging Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Slc25a20 G A 9: 108,680,209 probably null Het
Slc5a6 A T 5: 31,036,811 L634Q probably damaging Het
Slfn3 A G 11: 83,213,376 I235V possibly damaging Het
Smarcc1 T A 9: 110,175,099 L407Q probably damaging Het
Spata32 T C 11: 103,210,735 probably benign Het
Tdrd3 A G 14: 87,486,347 probably null Het
Thada A G 17: 84,436,702 V726A probably benign Het
Tmed7 A T 18: 46,588,555 probably null Het
Tmem161a G A 8: 70,180,785 G94S probably null Het
Tmem81 T A 1: 132,508,210 probably benign Het
Trim63 C A 4: 134,316,391 A55E probably damaging Het
Trmt1 A C 8: 84,689,267 probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Tshz3 T C 7: 36,771,654 S1023P possibly damaging Het
Upk3bl G A 5: 136,057,303 R31Q probably benign Het
Usp40 T C 1: 87,994,271 D290G probably benign Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r26 T A 6: 58,008,665 T180S probably benign Het
Wdr48 G T 9: 119,909,540 V89L probably benign Het
Wdr6 G T 9: 108,573,179 probably null Het
Zfp345 A G 2: 150,472,355 Y421H probably damaging Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4733:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTTGAAACTTCTGTACCACACAC -3'
(R):5'- TCCCTGGTGACCTCTGTGAG -3'

Sequencing Primer
(F):5'- CACACACACACAGAGAGAGAGAG -3'
(R):5'- GTGACCTCTGTGAGAGTCATACAATC -3'
Posted On2014-06-30