Incidental Mutation 'R0118:St7l'
ID20911
Institutional Source Beutler Lab
Gene Symbol St7l
Ensembl Gene ENSMUSG00000045576
Gene Namesuppression of tumorigenicity 7-like
SynonymsSt7r
MMRRC Submission 038404-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R0118 (G1)
Quality Score68
Status Validated (trace)
Chromosome3
Chromosomal Location104864005-104930064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104889303 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 237 (V237A)
Ref Sequence ENSEMBL: ENSMUSP00000138577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059271] [ENSMUST00000106769] [ENSMUST00000123876] [ENSMUST00000183914] [ENSMUST00000200132]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059271
AA Change: V244A

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058455
Gene: ENSMUSG00000045576
AA Change: V244A

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
Pfam:ST7 41 559 1.6e-292 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106769
AA Change: V244A

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102380
Gene: ENSMUSG00000045576
AA Change: V244A

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
Pfam:ST7 41 420 8.2e-209 PFAM
Pfam:ST7 419 527 1.4e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123876
AA Change: V237A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138577
Gene: ENSMUSG00000045576
AA Change: V237A

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
Pfam:ST7 41 282 6.7e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146237
Predicted Effect probably benign
Transcript: ENSMUST00000183914
SMART Domains Protein: ENSMUSP00000139266
Gene: ENSMUSG00000045576

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000197098
AA Change: V112A
Predicted Effect probably benign
Transcript: ENSMUST00000199335
Predicted Effect probably benign
Transcript: ENSMUST00000200132
SMART Domains Protein: ENSMUSP00000143759
Gene: ENSMUSG00000045576

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
Pfam:ST7 41 212 2.7e-81 PFAM
Pfam:ST7 209 481 1.3e-167 PFAM
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 89.3%
  • 20x: 67.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the ST7 tumor suppressor gene found in the chromosome 7q31 region. This gene is clustered in a tail-to-tail manner with the WNT2B gene in a chromosomal region known to be deleted and rearranged in a variety of cancers. Several transcript variants encoding many different isoforms have been described, but some have not been fully characterized. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T C 9: 30,911,744 R343G probably damaging Het
Asxl2 T G 12: 3,496,923 V569G probably damaging Het
Azin2 A C 4: 128,949,637 H85Q probably damaging Het
Cacna1a C T 8: 84,536,083 R324C probably damaging Het
Ccdc151 A T 9: 21,995,057 N224K probably benign Het
Ccr3 C A 9: 124,029,610 Y327* probably null Het
Cers2 T C 3: 95,320,226 F55S probably benign Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cntnap2 T C 6: 45,060,392 probably null Het
Cpn2 T C 16: 30,260,368 R172G probably benign Het
Ctdnep1 T C 11: 69,988,731 probably null Het
Dennd3 T A 15: 73,565,076 Y1051N probably damaging Het
Dmap1 T G 4: 117,676,483 Y196S probably damaging Het
Entpd7 G A 19: 43,704,312 W102* probably null Het
Frem2 A T 3: 53,535,243 C2624* probably null Het
Gdpd3 A G 7: 126,770,993 Y238C probably damaging Het
Gjb3 A G 4: 127,326,658 V27A probably damaging Het
Kat6b T C 14: 21,669,974 F1465L probably damaging Het
Klra17 A T 6: 129,831,589 M227K probably benign Het
Map6 A G 7: 99,317,617 D348G possibly damaging Het
Mapkbp1 T C 2: 120,025,215 S1472P probably benign Het
Megf6 C A 4: 154,254,641 P545Q probably damaging Het
Mertk C T 2: 128,759,166 R357W probably damaging Het
Mesd T A 7: 83,895,627 I104N probably damaging Het
Mrm3 T A 11: 76,249,955 V263E possibly damaging Het
Ndst4 T A 3: 125,611,561 Y488* probably null Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nfs1 T C 2: 156,134,524 H150R probably damaging Het
Olfr1500 A G 19: 13,827,565 F277S possibly damaging Het
Olfr27 T A 9: 39,144,103 M1K probably null Het
Olfr353 A G 2: 36,890,023 M275T probably benign Het
Olfr923 T C 9: 38,827,858 S50P possibly damaging Het
Pcdh8 T C 14: 79,767,408 Y1059C probably damaging Het
Pik3r5 T A 11: 68,490,480 L164Q probably damaging Het
Polr3g T C 13: 81,676,121 probably benign Het
Ppm1e T A 11: 87,231,738 K464N probably benign Het
Rims1 T C 1: 22,346,407 T1037A probably damaging Het
Rpgrip1l A T 8: 91,270,122 I108N probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Spem1 T C 11: 69,821,545 K98E possibly damaging Het
Tbc1d16 T C 11: 119,157,816 H337R probably damaging Het
Tbc1d32 T A 10: 56,017,605 I1291F probably benign Het
Tnfaip6 G T 2: 52,043,815 E61* probably null Het
Trib2 A T 12: 15,793,928 W102R probably damaging Het
Uimc1 G T 13: 55,085,644 N66K probably damaging Het
Vmn1r63 T A 7: 5,802,839 T265S probably benign Het
Vps35 G A 8: 85,294,953 T3I probably benign Het
Yeats2 T A 16: 20,156,942 L63* probably null Het
Zfp282 A G 6: 47,892,932 R304G probably benign Het
Other mutations in St7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:St7l APN 3 104873579 splice site probably benign
IGL00919:St7l APN 3 104926466 missense probably damaging 1.00
IGL00945:St7l APN 3 104926482 missense probably damaging 0.96
IGL01644:St7l APN 3 104919456 nonsense probably null
IGL02158:St7l APN 3 104874832 missense possibly damaging 0.48
IGL02164:St7l APN 3 104922281 critical splice donor site probably null
IGL02331:St7l APN 3 104926588 missense probably damaging 0.98
IGL03220:St7l APN 3 104874823 splice site probably benign
R0320:St7l UTSW 3 104870913 nonsense probably null
R0345:St7l UTSW 3 104895809 splice site probably benign
R0714:St7l UTSW 3 104874928 missense probably benign 0.06
R0784:St7l UTSW 3 104870924 missense probably benign 0.13
R1664:St7l UTSW 3 104870898 missense probably damaging 1.00
R1719:St7l UTSW 3 104870987 missense probably benign 0.00
R1800:St7l UTSW 3 104919496 missense probably damaging 1.00
R1882:St7l UTSW 3 104868047 missense probably damaging 1.00
R3692:St7l UTSW 3 104891554 missense probably benign 0.27
R3879:St7l UTSW 3 104926447 missense probably damaging 1.00
R5130:St7l UTSW 3 104895764 missense probably damaging 1.00
R5271:St7l UTSW 3 104868060 missense probably damaging 1.00
R5887:St7l UTSW 3 104874928 missense probably benign 0.06
R6191:St7l UTSW 3 104868033 missense probably damaging 1.00
R6252:St7l UTSW 3 104919503 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGTAGCTTAGAGCAAGTGTGACC -3'
(R):5'- CTCACCTACATGGCAAATCGGAGG -3'

Sequencing Primer
(F):5'- TGGATAAAACATTGTGGAGTTGG -3'
(R):5'- CAAATCGGAGGTTAACACCTTG -3'
Posted On2013-04-11