Incidental Mutation 'R0118:Dmap1'
ID20913
Institutional Source Beutler Lab
Gene Symbol Dmap1
Ensembl Gene ENSMUSG00000009640
Gene NameDNA methyltransferase 1-associated protein 1
Synonyms1500016M21Rik
MMRRC Submission 038404-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0118 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location117674681-117682273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 117676483 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 196 (Y196S)
Ref Sequence ENSEMBL: ENSMUSP00000099748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037127] [ENSMUST00000102687]
Predicted Effect probably benign
Transcript: ENSMUST00000037127
SMART Domains Protein: ENSMUSP00000042796
Gene: ENSMUSG00000033423

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
EXOIII 145 329 1.17e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102687
AA Change: Y196S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099748
Gene: ENSMUSG00000009640
AA Change: Y196S

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
SANT 148 201 3.38e-2 SMART
Pfam:DMAP1 243 404 7.1e-76 PFAM
low complexity region 449 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146384
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 89.3%
  • 20x: 67.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of several, distinct complexes involved in the repression or activation of transcription. The encoded protein can independently repress transcription and is targeted to replication foci throughout S phase by interacting directly with the N-terminus of DNA methyltransferase 1. During late S phase, histone deacetylase 2 is added to this complex, providing a means to deacetylate histones in transcriptionally inactive heterochromatin following replication. The encoded protein is also a component of the nucleosome acetyltransferase of H4 complex and interacts with the transcriptional corepressor tumor susceptibility gene 101 and the pro-apoptotic death-associated protein 6, among others. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation with no 8-cell embryos detected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T C 9: 30,911,744 R343G probably damaging Het
Asxl2 T G 12: 3,496,923 V569G probably damaging Het
Azin2 A C 4: 128,949,637 H85Q probably damaging Het
Cacna1a C T 8: 84,536,083 R324C probably damaging Het
Ccdc151 A T 9: 21,995,057 N224K probably benign Het
Ccr3 C A 9: 124,029,610 Y327* probably null Het
Cers2 T C 3: 95,320,226 F55S probably benign Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cntnap2 T C 6: 45,060,392 probably null Het
Cpn2 T C 16: 30,260,368 R172G probably benign Het
Ctdnep1 T C 11: 69,988,731 probably null Het
Dennd3 T A 15: 73,565,076 Y1051N probably damaging Het
Entpd7 G A 19: 43,704,312 W102* probably null Het
Frem2 A T 3: 53,535,243 C2624* probably null Het
Gdpd3 A G 7: 126,770,993 Y238C probably damaging Het
Gjb3 A G 4: 127,326,658 V27A probably damaging Het
Kat6b T C 14: 21,669,974 F1465L probably damaging Het
Klra17 A T 6: 129,831,589 M227K probably benign Het
Map6 A G 7: 99,317,617 D348G possibly damaging Het
Mapkbp1 T C 2: 120,025,215 S1472P probably benign Het
Megf6 C A 4: 154,254,641 P545Q probably damaging Het
Mertk C T 2: 128,759,166 R357W probably damaging Het
Mesd T A 7: 83,895,627 I104N probably damaging Het
Mrm3 T A 11: 76,249,955 V263E possibly damaging Het
Ndst4 T A 3: 125,611,561 Y488* probably null Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nfs1 T C 2: 156,134,524 H150R probably damaging Het
Olfr1500 A G 19: 13,827,565 F277S possibly damaging Het
Olfr27 T A 9: 39,144,103 M1K probably null Het
Olfr353 A G 2: 36,890,023 M275T probably benign Het
Olfr923 T C 9: 38,827,858 S50P possibly damaging Het
Pcdh8 T C 14: 79,767,408 Y1059C probably damaging Het
Pik3r5 T A 11: 68,490,480 L164Q probably damaging Het
Polr3g T C 13: 81,676,121 probably benign Het
Ppm1e T A 11: 87,231,738 K464N probably benign Het
Rims1 T C 1: 22,346,407 T1037A probably damaging Het
Rpgrip1l A T 8: 91,270,122 I108N probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Spem1 T C 11: 69,821,545 K98E possibly damaging Het
St7l T C 3: 104,889,303 V237A probably damaging Het
Tbc1d16 T C 11: 119,157,816 H337R probably damaging Het
Tbc1d32 T A 10: 56,017,605 I1291F probably benign Het
Tnfaip6 G T 2: 52,043,815 E61* probably null Het
Trib2 A T 12: 15,793,928 W102R probably damaging Het
Uimc1 G T 13: 55,085,644 N66K probably damaging Het
Vmn1r63 T A 7: 5,802,839 T265S probably benign Het
Vps35 G A 8: 85,294,953 T3I probably benign Het
Yeats2 T A 16: 20,156,942 L63* probably null Het
Zfp282 A G 6: 47,892,932 R304G probably benign Het
Other mutations in Dmap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Dmap1 APN 4 117676396 missense possibly damaging 0.67
IGL01517:Dmap1 APN 4 117676009 missense probably damaging 1.00
IGL02926:Dmap1 APN 4 117681888 missense probably benign 0.01
R1586:Dmap1 UTSW 4 117676122 missense probably damaging 0.98
R2504:Dmap1 UTSW 4 117675298 missense probably damaging 1.00
R2940:Dmap1 UTSW 4 117676005 missense possibly damaging 0.72
R4168:Dmap1 UTSW 4 117681310 missense possibly damaging 0.91
R4723:Dmap1 UTSW 4 117676039 missense probably benign 0.05
R4975:Dmap1 UTSW 4 117681036 missense possibly damaging 0.91
R5797:Dmap1 UTSW 4 117675480 missense possibly damaging 0.94
R5905:Dmap1 UTSW 4 117676766 missense probably benign 0.00
R5987:Dmap1 UTSW 4 117680842 critical splice donor site probably null
R6117:Dmap1 UTSW 4 117675535 intron probably null
Predicted Primers PCR Primer
(F):5'- TTTCCGGGCCTCAATCTTACGCAG -3'
(R):5'- CGGTATGACCACCAGCAGTTCAAG -3'

Sequencing Primer
(F):5'- CTGACGGGACACTAGGTTATC -3'
(R):5'- TCAAGGTGAGCTGCTATGCAC -3'
Posted On2013-04-11