Mutagenetix > Incidental Mutation

Incidental Mutation 'R0118:Azin2'

20915

Institutional Source

Beutler Lab

Gene Symbol

Azin2

Ensembl Gene

ENSMUSG00000028789

Gene Name

antizyme inhibitor 2

Synonyms

Adc, Odcp, 4933429I20Rik, AZIN2

MMRRC Submission

038404-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.314) question?

Stock #

R0118 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

128824026-128856235 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 128843430 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 85 (H85Q)

Ref Sequence

ENSEMBL: ENSMUSP00000114086 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030581] [ENSMUST00000106068] [ENSMUST00000119354] [ENSMUST00000147731]

AlphaFold

Q8BVM4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030581
AA Change: H180Q

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000030581
Gene: ENSMUSG00000028789
AA Change: H180Q

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	45	283	1.9e-69	PFAM
Pfam:Orn_DAP_Arg_deC	286	407	1.7e-22	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106068
AA Change: H180Q

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101683
Gene: ENSMUSG00000028789
AA Change: H180Q

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	45	283	6.7e-73	PFAM
Pfam:Orn_DAP_Arg_deC	287	406	1.9e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119354
AA Change: H85Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000114086
Gene: ENSMUSG00000028789
AA Change: H85Q

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	1	188	4.2e-54	PFAM
Pfam:Orn_DAP_Arg_deC	191	312	4.3e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128820

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143912

Predicted Effect

probably benign
Transcript: ENSMUST00000147731
AA Change: H99Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000122240
Gene: ENSMUSG00000028789
AA Change: H99Q

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	2	202	4e-56	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.8%
3x: 97.2%
10x: 89.3%
20x: 67.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 2, the second member of this gene family. Like antizyme inhibitor 1, antizyme inhibitor 2 interacts with all 3 antizymes and stimulates ODC activity and polyamine uptake. However, unlike antizyme inhibitor 1, which is ubiquitously expressed and localized in the nucleus and cytoplasm, antizyme inhibitor 2 is predominantly expressed in the brain and testis and localized in the endoplasmic reticulum-golgi intermediate compartment. Recent studies indicate that antizyme inhibitor 2 is also expressed in specific cell types in ovaries, adrenal glands and pancreas, and in mast cells. The exact function of this gene is not known, however, available data suggest its role in cell growth, spermiogenesis, vesicular trafficking and secretion. There has been confusion in literature and databases over the nomenclature of this gene, stemming from an earlier report that a human cDNA clone (identical to ODCp/AZIN2) had arginine decarboxylase (ADC) activity (PMID:14738999). Subsequent studies in human and mouse showed that antizyme inhibitor 2 was devoid of arginine decarboxylase activity (PMID:19956990). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased circulating insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	T	C	9: 30,823,040 (GRCm39)	R343G	probably damaging	Het
Asxl2	T	G	12: 3,546,923 (GRCm39)	V569G	probably damaging	Het
Cacna1a	C	T	8: 85,262,712 (GRCm39)	R324C	probably damaging	Het
Ccr3	C	A	9: 123,829,647 (GRCm39)	Y327*	probably null	Het
Cers2	T	C	3: 95,227,537 (GRCm39)	F55S	probably benign	Het
Cic	C	T	7: 24,985,459 (GRCm39)	S301L	probably damaging	Het
Cntnap2	T	C	6: 45,037,326 (GRCm39)		probably null	Het
Cpn2	T	C	16: 30,079,186 (GRCm39)	R172G	probably benign	Het
Ctdnep1	T	C	11: 69,879,557 (GRCm39)		probably null	Het
Dennd3	T	A	15: 73,436,925 (GRCm39)	Y1051N	probably damaging	Het
Dmap1	T	G	4: 117,533,680 (GRCm39)	Y196S	probably damaging	Het
Entpd7	G	A	19: 43,692,751 (GRCm39)	W102*	probably null	Het
Frem2	A	T	3: 53,442,664 (GRCm39)	C2624*	probably null	Het
Gdpd3	A	G	7: 126,370,165 (GRCm39)	Y238C	probably damaging	Het
Gjb3	A	G	4: 127,220,451 (GRCm39)	V27A	probably damaging	Het
Kat6b	T	C	14: 21,720,042 (GRCm39)	F1465L	probably damaging	Het
Klra17	A	T	6: 129,808,552 (GRCm39)	M227K	probably benign	Het
Map6	A	G	7: 98,966,824 (GRCm39)	D348G	possibly damaging	Het
Mapkbp1	T	C	2: 119,855,696 (GRCm39)	S1472P	probably benign	Het
Megf6	C	A	4: 154,339,098 (GRCm39)	P545Q	probably damaging	Het
Mertk	C	T	2: 128,601,086 (GRCm39)	R357W	probably damaging	Het
Mesd	T	A	7: 83,544,835 (GRCm39)	I104N	probably damaging	Het
Mrm3	T	A	11: 76,140,781 (GRCm39)	V263E	possibly damaging	Het
Ndst4	T	A	3: 125,405,210 (GRCm39)	Y488*	probably null	Het
Nfat5	C	T	8: 108,065,707 (GRCm39)	R156W	probably damaging	Het
Nfs1	T	C	2: 155,976,444 (GRCm39)	H150R	probably damaging	Het
Odad3	A	T	9: 21,906,353 (GRCm39)	N224K	probably benign	Het
Or1n1b	A	G	2: 36,780,035 (GRCm39)	M275T	probably benign	Het
Or8b56	T	C	9: 38,739,154 (GRCm39)	S50P	possibly damaging	Het
Or8g19	T	A	9: 39,055,399 (GRCm39)	M1K	probably null	Het
Or9q1	A	G	19: 13,804,929 (GRCm39)	F277S	possibly damaging	Het
Pcdh8	T	C	14: 80,004,848 (GRCm39)	Y1059C	probably damaging	Het
Pik3r5	T	A	11: 68,381,306 (GRCm39)	L164Q	probably damaging	Het
Polr3g	T	C	13: 81,824,240 (GRCm39)		probably benign	Het
Ppm1e	T	A	11: 87,122,564 (GRCm39)	K464N	probably benign	Het
Rims1	T	C	1: 22,416,631 (GRCm39)	T1037A	probably damaging	Het
Rpgrip1l	A	T	8: 91,996,750 (GRCm39)	I108N	probably damaging	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,127,419 (GRCm39)		probably benign	Het
Spem1	T	C	11: 69,712,371 (GRCm39)	K98E	possibly damaging	Het
St7l	T	C	3: 104,796,619 (GRCm39)	V237A	probably damaging	Het
Tbc1d16	T	C	11: 119,048,642 (GRCm39)	H337R	probably damaging	Het
Tbc1d32	T	A	10: 55,893,701 (GRCm39)	I1291F	probably benign	Het
Tnfaip6	G	T	2: 51,933,827 (GRCm39)	E61*	probably null	Het
Trib2	A	T	12: 15,843,929 (GRCm39)	W102R	probably damaging	Het
Uimc1	G	T	13: 55,233,457 (GRCm39)	N66K	probably damaging	Het
Vmn1r63	T	A	7: 5,805,838 (GRCm39)	T265S	probably benign	Het
Vps35	G	A	8: 86,021,582 (GRCm39)	T3I	probably benign	Het
Yeats2	T	A	16: 19,975,692 (GRCm39)	L63*	probably null	Het
Zfp282	A	G	6: 47,869,866 (GRCm39)	R304G	probably benign	Het

Other mutations in Azin2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Azin2	APN	4	128,844,459 (GRCm39)	missense	probably damaging	1.00
IGL02040:Azin2	APN	4	128,844,451 (GRCm39)	missense	possibly damaging	0.78
IGL03349:Azin2	APN	4	128,839,907 (GRCm39)	nonsense	probably null
R1215:Azin2	UTSW	4	128,843,489 (GRCm39)	missense	probably damaging	0.96
R1940:Azin2	UTSW	4	128,844,577 (GRCm39)	splice site	probably null
R2939:Azin2	UTSW	4	128,828,397 (GRCm39)	missense	probably benign	0.44
R4899:Azin2	UTSW	4	128,828,446 (GRCm39)	missense	probably benign	0.43
R5836:Azin2	UTSW	4	128,842,670 (GRCm39)	missense	probably damaging	1.00
R6511:Azin2	UTSW	4	128,828,259 (GRCm39)	missense	probably damaging	1.00
R9059:Azin2	UTSW	4	128,828,440 (GRCm39)	missense	probably benign	0.03
R9209:Azin2	UTSW	4	128,841,341 (GRCm39)	missense	probably damaging	0.99
R9266:Azin2	UTSW	4	128,856,230 (GRCm39)	unclassified	probably benign
R9595:Azin2	UTSW	4	128,853,617 (GRCm39)	missense	probably benign	0.03
T0722:Azin2	UTSW	4	128,839,927 (GRCm39)	missense	probably benign	0.00
T0975:Azin2	UTSW	4	128,839,927 (GRCm39)	missense	probably benign	0.00
Z1176:Azin2	UTSW	4	128,828,452 (GRCm39)	missense	possibly damaging	0.54

Predicted Primers

PCR Primer
(F):5'- AAGGACACTCTCTGGTGGCAAAAC -3'
(R):5'- GTGATCTAGAAAGGCTGTGCGCTC -3'

Sequencing Primer
(F):5'- ATTCCTGGGAGAAAGGGTAGTG -3'
(R):5'- TCAGTGGCCTCTCAGCTAAG -3'

Posted On

2013-04-11