Incidental Mutation 'R1882:Pecr'
ID209157
Institutional Source Beutler Lab
Gene Symbol Pecr
Ensembl Gene ENSMUSG00000026189
Gene Nameperoxisomal trans-2-enoyl-CoA reductase
Synonyms
MMRRC Submission 039903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1882 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location72259167-72284314 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 72274977 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027381] [ENSMUST00000027381] [ENSMUST00000097698] [ENSMUST00000097698] [ENSMUST00000129458] [ENSMUST00000134840] [ENSMUST00000134840]
Predicted Effect probably null
Transcript: ENSMUST00000027381
SMART Domains Protein: ENSMUSP00000027381
Gene: ENSMUSG00000026189

DomainStartEndE-ValueType
Pfam:adh_short 19 216 5e-47 PFAM
Pfam:KR 20 148 2.3e-10 PFAM
Pfam:adh_short_C2 25 266 4.1e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000027381
SMART Domains Protein: ENSMUSP00000027381
Gene: ENSMUSG00000026189

DomainStartEndE-ValueType
Pfam:adh_short 19 216 5e-47 PFAM
Pfam:KR 20 148 2.3e-10 PFAM
Pfam:adh_short_C2 25 266 4.1e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000097698
SMART Domains Protein: ENSMUSP00000095304
Gene: ENSMUSG00000026189

DomainStartEndE-ValueType
Pfam:adh_short 19 190 5.8e-26 PFAM
Pfam:KR 20 148 9.3e-12 PFAM
Pfam:adh_short_C2 25 242 8.7e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000097698
SMART Domains Protein: ENSMUSP00000095304
Gene: ENSMUSG00000026189

DomainStartEndE-ValueType
Pfam:adh_short 19 190 5.8e-26 PFAM
Pfam:KR 20 148 9.3e-12 PFAM
Pfam:adh_short_C2 25 242 8.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129458
Predicted Effect probably benign
Transcript: ENSMUST00000134840
SMART Domains Protein: ENSMUSP00000120890
Gene: ENSMUSG00000026189

DomainStartEndE-ValueType
Pfam:adh_short 19 89 1.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134840
SMART Domains Protein: ENSMUSP00000120890
Gene: ENSMUSG00000026189

DomainStartEndE-ValueType
Pfam:adh_short 19 89 1.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180722
Meta Mutation Damage Score 0.6516 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,798,506 S189P probably benign Het
Adgrg3 G T 8: 95,040,315 V433F probably benign Het
Arhgap33 A T 7: 30,522,809 W1233R probably damaging Het
Brf2 T C 8: 27,128,549 D9G probably damaging Het
Btrc G A 19: 45,527,400 R562Q probably damaging Het
Cenpu T C 8: 46,556,190 F67L probably damaging Het
Chia1 T C 3: 106,128,474 M150T probably damaging Het
Cntln A G 4: 85,100,835 E1254G probably damaging Het
Creld1 G A 6: 113,492,205 C332Y probably damaging Het
Ctla2a A G 13: 60,935,541 probably benign Het
Dusp13 A T 14: 21,734,975 D223E probably benign Het
Ext1 C A 15: 53,075,792 L620F probably damaging Het
Gm6614 C A 6: 141,993,637 probably null Het
H2-DMb2 C T 17: 34,147,860 R89C probably damaging Het
Klhl32 A T 4: 24,743,916 L17* probably null Het
Lats2 C T 14: 57,697,354 V640M probably damaging Het
Lrig3 G A 10: 126,009,825 V708I possibly damaging Het
Mtcl1 T C 17: 66,379,320 T415A probably benign Het
Mynn A G 3: 30,616,813 *611W probably null Het
Nfx1 A G 4: 41,009,240 T793A possibly damaging Het
Nlrp4d T C 7: 10,382,677 noncoding transcript Het
Nos3 T C 5: 24,368,820 V194A probably damaging Het
Npc1l1 C T 11: 6,217,473 probably null Het
Nrg2 T C 18: 36,021,097 D589G probably damaging Het
Olfr1008 T A 2: 85,689,606 M59K probably damaging Het
Olfr126 T C 17: 37,850,948 S119P probably damaging Het
Olfr1390 A G 11: 49,340,712 Y60C probably damaging Het
Olfr1418 T C 19: 11,855,471 T161A probably damaging Het
Omg C T 11: 79,501,719 probably benign Het
P2ry2 G T 7: 100,998,851 Y82* probably null Het
Pcdh1 T C 18: 38,202,842 T247A possibly damaging Het
Pgm3 A G 9: 86,565,690 Y167H possibly damaging Het
Pramef20 A T 4: 144,376,915 C214S probably benign Het
Prmt2 T C 10: 76,222,468 H169R probably benign Het
Rad51ap2 T A 12: 11,456,250 S58T possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Slc6a15 T C 10: 103,395,064 S217P probably benign Het
Snx27 G A 3: 94,519,109 T361I probably damaging Het
St7l A G 3: 104,868,047 T80A probably damaging Het
Stk32b T A 5: 37,531,687 M98L possibly damaging Het
Tonsl C A 15: 76,624,150 A6S possibly damaging Het
Tpx2 A G 2: 152,869,691 R49G probably benign Het
Trmt2a A G 16: 18,249,894 K144E possibly damaging Het
Trpm7 A C 2: 126,812,777 L1414V probably benign Het
Ugdh T C 5: 65,423,596 K107E possibly damaging Het
Vamp3 A T 4: 151,050,909 probably benign Het
Vmn1r172 T C 7: 23,660,226 S179P probably damaging Het
Vmn1r28 A G 6: 58,265,978 M269V probably benign Het
Vmn2r94 T C 17: 18,244,214 T605A probably benign Het
Vwce A G 19: 10,638,156 T134A possibly damaging Het
Zfp277 T C 12: 40,445,746 E5G probably benign Het
Other mutations in Pecr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03124:Pecr APN 1 72277340 missense probably benign 0.04
R1556:Pecr UTSW 1 72259383 missense probably benign
R1711:Pecr UTSW 1 72277409 missense possibly damaging 0.93
R2150:Pecr UTSW 1 72277358 missense possibly damaging 0.73
R2507:Pecr UTSW 1 72261976 missense probably benign 0.11
R2516:Pecr UTSW 1 72277310 missense probably damaging 1.00
R3774:Pecr UTSW 1 72259371 missense probably benign 0.00
R3775:Pecr UTSW 1 72259371 missense probably benign 0.00
R3968:Pecr UTSW 1 72276309 missense probably damaging 0.99
R3969:Pecr UTSW 1 72276309 missense probably damaging 0.99
R3970:Pecr UTSW 1 72276309 missense probably damaging 0.99
R4171:Pecr UTSW 1 72276269 missense probably damaging 1.00
R4773:Pecr UTSW 1 72267435 missense probably damaging 1.00
R4864:Pecr UTSW 1 72277331 missense probably benign 0.35
R5191:Pecr UTSW 1 72274977 splice site probably null
R5259:Pecr UTSW 1 72277285 critical splice donor site probably null
R5331:Pecr UTSW 1 72274846 intron probably benign
R6828:Pecr UTSW 1 72267457 nonsense probably null
R7238:Pecr UTSW 1 72259433 missense probably damaging 0.99
R7358:Pecr UTSW 1 72267465 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGTGAATCATTGATTTAGTCCC -3'
(R):5'- CTGAGTCACTGTTCCAGTAATTTAC -3'

Sequencing Primer
(F):5'- GCTGTTGGAAACCCATTAT -3'
(R):5'- ATTTGAAGCTCTCACTGACCG -3'
Posted On2014-06-30