Incidental Mutation 'R1882:Vamp3'
ID 209169
Institutional Source Beutler Lab
Gene Symbol Vamp3
Ensembl Gene ENSMUSG00000028955
Gene Name vesicle-associated membrane protein 3
Synonyms cellubrevin, D130027G05Rik, VAMP-3, ceb
MMRRC Submission 039903-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1882 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 151131762-151142410 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to T at 151135366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030797] [ENSMUST00000169423]
AlphaFold P63024
Predicted Effect probably benign
Transcript: ENSMUST00000030797
SMART Domains Protein: ENSMUSP00000030797
Gene: ENSMUSG00000028955

DomainStartEndE-ValueType
Pfam:Synaptobrevin 15 103 4.2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155446
Predicted Effect probably benign
Transcript: ENSMUST00000169423
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. This gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Because of its high homology to other known VAMPs, its broad tissue distribution, and its subcellular localization, the protein encoded by this gene was shown to be the human equivalent of the rodent cellubrevin. In platelets the protein resides on a compartment that is not mobilized to the plasma membrane on calcium or thrombin stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack vesicle-associated membrane protein 3 but are apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,786,945 (GRCm39) S189P probably benign Het
Adgrg3 G T 8: 95,766,943 (GRCm39) V433F probably benign Het
Arhgap33 A T 7: 30,222,234 (GRCm39) W1233R probably damaging Het
Brf2 T C 8: 27,618,577 (GRCm39) D9G probably damaging Het
Btrc G A 19: 45,515,839 (GRCm39) R562Q probably damaging Het
Cenpu T C 8: 47,009,225 (GRCm39) F67L probably damaging Het
Chia1 T C 3: 106,035,790 (GRCm39) M150T probably damaging Het
Cntln A G 4: 85,019,072 (GRCm39) E1254G probably damaging Het
Creld1 G A 6: 113,469,166 (GRCm39) C332Y probably damaging Het
Ctla2a A G 13: 61,083,355 (GRCm39) probably benign Het
Dusp13b A T 14: 21,785,043 (GRCm39) D223E probably benign Het
Ext1 C A 15: 52,939,188 (GRCm39) L620F probably damaging Het
H2-DMb2 C T 17: 34,366,834 (GRCm39) R89C probably damaging Het
Klhl32 A T 4: 24,743,916 (GRCm39) L17* probably null Het
Lats2 C T 14: 57,934,811 (GRCm39) V640M probably damaging Het
Lrig3 G A 10: 125,845,694 (GRCm39) V708I possibly damaging Het
Mtcl1 T C 17: 66,686,315 (GRCm39) T415A probably benign Het
Mynn A G 3: 30,670,962 (GRCm39) *611W probably null Het
Nfx1 A G 4: 41,009,240 (GRCm39) T793A possibly damaging Het
Nlrp4d T C 7: 10,116,604 (GRCm39) noncoding transcript Het
Nos3 T C 5: 24,573,818 (GRCm39) V194A probably damaging Het
Npc1l1 C T 11: 6,167,473 (GRCm39) probably null Het
Nrg2 T C 18: 36,154,150 (GRCm39) D589G probably damaging Het
Omg C T 11: 79,392,545 (GRCm39) probably benign Het
Or10v9 T C 19: 11,832,835 (GRCm39) T161A probably damaging Het
Or14j5 T C 17: 38,161,839 (GRCm39) S119P probably damaging Het
Or2y17 A G 11: 49,231,539 (GRCm39) Y60C probably damaging Het
Or8k16 T A 2: 85,519,950 (GRCm39) M59K probably damaging Het
P2ry2 G T 7: 100,648,058 (GRCm39) Y82* probably null Het
Pcdh1 T C 18: 38,335,895 (GRCm39) T247A possibly damaging Het
Pecr A T 1: 72,314,136 (GRCm39) probably null Het
Pgm3 A G 9: 86,447,743 (GRCm39) Y167H possibly damaging Het
Pramel15 A T 4: 144,103,485 (GRCm39) C214S probably benign Het
Prmt2 T C 10: 76,058,302 (GRCm39) H169R probably benign Het
Rad51ap2 T A 12: 11,506,251 (GRCm39) S58T possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Slc6a15 T C 10: 103,230,925 (GRCm39) S217P probably benign Het
Slco1a8 C A 6: 141,939,363 (GRCm39) probably null Het
Snx27 G A 3: 94,426,416 (GRCm39) T361I probably damaging Het
St7l A G 3: 104,775,363 (GRCm39) T80A probably damaging Het
Stk32b T A 5: 37,689,031 (GRCm39) M98L possibly damaging Het
Tonsl C A 15: 76,508,350 (GRCm39) A6S possibly damaging Het
Tpx2 A G 2: 152,711,611 (GRCm39) R49G probably benign Het
Trmt2a A G 16: 18,067,758 (GRCm39) K144E possibly damaging Het
Trpm7 A C 2: 126,654,697 (GRCm39) L1414V probably benign Het
Ugdh T C 5: 65,580,939 (GRCm39) K107E possibly damaging Het
Vmn1r172 T C 7: 23,359,651 (GRCm39) S179P probably damaging Het
Vmn1r28 A G 6: 58,242,963 (GRCm39) M269V probably benign Het
Vmn2r94 T C 17: 18,464,476 (GRCm39) T605A probably benign Het
Vwce A G 19: 10,615,520 (GRCm39) T134A possibly damaging Het
Zfp277 T C 12: 40,495,745 (GRCm39) E5G probably benign Het
Other mutations in Vamp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1944:Vamp3 UTSW 4 151,140,617 (GRCm39) critical splice donor site probably null
R5543:Vamp3 UTSW 4 151,135,477 (GRCm39) missense probably damaging 1.00
R8540:Vamp3 UTSW 4 151,135,507 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTACCTAGGTCTAGTGCCCAC -3'
(R):5'- CCATGTCCATTTAGGTGGTTGAC -3'

Sequencing Primer
(F):5'- TAGGTCTAGTGCCCACGACTG -3'
(R):5'- TGGTTGACATCATGAGAGTCAATG -3'
Posted On 2014-06-30