Incidental Mutation 'R0118:Megf6'
ID20917
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
MMRRC Submission 038404-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R0118 (G1)
Quality Score206
Status Validated (trace)
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 154254641 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 545 (P545Q)
Ref Sequence ENSEMBL: ENSMUSP00000030897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
Predicted Effect probably damaging
Transcript: ENSMUST00000030897
AA Change: P545Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751
AA Change: P545Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152159
AA Change: P437Q

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751
AA Change: P437Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183595
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 89.3%
  • 20x: 67.4%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T C 9: 30,911,744 R343G probably damaging Het
Asxl2 T G 12: 3,496,923 V569G probably damaging Het
Azin2 A C 4: 128,949,637 H85Q probably damaging Het
Cacna1a C T 8: 84,536,083 R324C probably damaging Het
Ccdc151 A T 9: 21,995,057 N224K probably benign Het
Ccr3 C A 9: 124,029,610 Y327* probably null Het
Cers2 T C 3: 95,320,226 F55S probably benign Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cntnap2 T C 6: 45,060,392 probably null Het
Cpn2 T C 16: 30,260,368 R172G probably benign Het
Ctdnep1 T C 11: 69,988,731 probably null Het
Dennd3 T A 15: 73,565,076 Y1051N probably damaging Het
Dmap1 T G 4: 117,676,483 Y196S probably damaging Het
Entpd7 G A 19: 43,704,312 W102* probably null Het
Frem2 A T 3: 53,535,243 C2624* probably null Het
Gdpd3 A G 7: 126,770,993 Y238C probably damaging Het
Gjb3 A G 4: 127,326,658 V27A probably damaging Het
Kat6b T C 14: 21,669,974 F1465L probably damaging Het
Klra17 A T 6: 129,831,589 M227K probably benign Het
Map6 A G 7: 99,317,617 D348G possibly damaging Het
Mapkbp1 T C 2: 120,025,215 S1472P probably benign Het
Mertk C T 2: 128,759,166 R357W probably damaging Het
Mesd T A 7: 83,895,627 I104N probably damaging Het
Mrm3 T A 11: 76,249,955 V263E possibly damaging Het
Ndst4 T A 3: 125,611,561 Y488* probably null Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nfs1 T C 2: 156,134,524 H150R probably damaging Het
Olfr1500 A G 19: 13,827,565 F277S possibly damaging Het
Olfr27 T A 9: 39,144,103 M1K probably null Het
Olfr353 A G 2: 36,890,023 M275T probably benign Het
Olfr923 T C 9: 38,827,858 S50P possibly damaging Het
Pcdh8 T C 14: 79,767,408 Y1059C probably damaging Het
Pik3r5 T A 11: 68,490,480 L164Q probably damaging Het
Polr3g T C 13: 81,676,121 probably benign Het
Ppm1e T A 11: 87,231,738 K464N probably benign Het
Rims1 T C 1: 22,346,407 T1037A probably damaging Het
Rpgrip1l A T 8: 91,270,122 I108N probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Spem1 T C 11: 69,821,545 K98E possibly damaging Het
St7l T C 3: 104,889,303 V237A probably damaging Het
Tbc1d16 T C 11: 119,157,816 H337R probably damaging Het
Tbc1d32 T A 10: 56,017,605 I1291F probably benign Het
Tnfaip6 G T 2: 52,043,815 E61* probably null Het
Trib2 A T 12: 15,793,928 W102R probably damaging Het
Uimc1 G T 13: 55,085,644 N66K probably damaging Het
Vmn1r63 T A 7: 5,802,839 T265S probably benign Het
Vps35 G A 8: 85,294,953 T3I probably benign Het
Yeats2 T A 16: 20,156,942 L63* probably null Het
Zfp282 A G 6: 47,892,932 R304G probably benign Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0526:Megf6 UTSW 4 154258941 missense probably benign
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1831:Megf6 UTSW 4 154270677 missense probably benign 0.00
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154267667 missense probably damaging 1.00
R2109:Megf6 UTSW 4 154177121 missense probably benign 0.39
R2448:Megf6 UTSW 4 154266645 intron probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4058:Megf6 UTSW 4 154242532 splice site probably benign
R4672:Megf6 UTSW 4 154249452 missense probably damaging 0.99
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154267226 missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5808:Megf6 UTSW 4 154267662 missense probably benign
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154263179 missense probably benign 0.06
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTCAGTGGGCGGCAAAG -3'
(R):5'- TGGGTGAGTGGACAGATGGTCAG -3'

Sequencing Primer
(F):5'- AAGCTCATCTGGGGTTCAAC -3'
(R):5'- TCAGACAGAGGGGTGTGTG -3'
Posted On2013-04-11