Incidental Mutation 'R1882:Nos3'
ID209171
Institutional Source Beutler Lab
Gene Symbol Nos3
Ensembl Gene ENSMUSG00000028978
Gene Namenitric oxide synthase 3, endothelial cell
SynonymseNOS, 2310065A03Rik, ecNOS, Nos-3
MMRRC Submission 039903-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.683) question?
Stock #R1882 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24364810-24384474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24368820 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 194 (V194A)
Ref Sequence ENSEMBL: ENSMUSP00000030834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000115090]
Predicted Effect probably damaging
Transcript: ENSMUST00000030834
AA Change: V194A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978
AA Change: V194A

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 118 480 1.7e-183 PFAM
Pfam:Flavodoxin_1 521 697 4.8e-54 PFAM
Pfam:FAD_binding_1 750 978 2.1e-82 PFAM
Pfam:NAD_binding_1 1010 1124 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115090
AA Change: V194A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978
AA Change: V194A

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 114 485 9e-214 PFAM
Pfam:Flavodoxin_1 521 697 3.8e-54 PFAM
Pfam:FAD_binding_1 750 978 1.6e-79 PFAM
Pfam:NAD_binding_1 1010 1091 5.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156403
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced survival, hypertension, inhibited basal vasodilation, insulin resistance, fewer mitochondria, reduced heart rate, impaired ovulation and, in some, shortened limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,798,506 S189P probably benign Het
Adgrg3 G T 8: 95,040,315 V433F probably benign Het
Arhgap33 A T 7: 30,522,809 W1233R probably damaging Het
Brf2 T C 8: 27,128,549 D9G probably damaging Het
Btrc G A 19: 45,527,400 R562Q probably damaging Het
Cenpu T C 8: 46,556,190 F67L probably damaging Het
Chia1 T C 3: 106,128,474 M150T probably damaging Het
Cntln A G 4: 85,100,835 E1254G probably damaging Het
Creld1 G A 6: 113,492,205 C332Y probably damaging Het
Ctla2a A G 13: 60,935,541 probably benign Het
Dusp13 A T 14: 21,734,975 D223E probably benign Het
Ext1 C A 15: 53,075,792 L620F probably damaging Het
Gm6614 C A 6: 141,993,637 probably null Het
H2-DMb2 C T 17: 34,147,860 R89C probably damaging Het
Klhl32 A T 4: 24,743,916 L17* probably null Het
Lats2 C T 14: 57,697,354 V640M probably damaging Het
Lrig3 G A 10: 126,009,825 V708I possibly damaging Het
Mtcl1 T C 17: 66,379,320 T415A probably benign Het
Mynn A G 3: 30,616,813 *611W probably null Het
Nfx1 A G 4: 41,009,240 T793A possibly damaging Het
Nlrp4d T C 7: 10,382,677 noncoding transcript Het
Npc1l1 C T 11: 6,217,473 probably null Het
Nrg2 T C 18: 36,021,097 D589G probably damaging Het
Olfr1008 T A 2: 85,689,606 M59K probably damaging Het
Olfr126 T C 17: 37,850,948 S119P probably damaging Het
Olfr1390 A G 11: 49,340,712 Y60C probably damaging Het
Olfr1418 T C 19: 11,855,471 T161A probably damaging Het
Omg C T 11: 79,501,719 probably benign Het
P2ry2 G T 7: 100,998,851 Y82* probably null Het
Pcdh1 T C 18: 38,202,842 T247A possibly damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pgm3 A G 9: 86,565,690 Y167H possibly damaging Het
Pramef20 A T 4: 144,376,915 C214S probably benign Het
Prmt2 T C 10: 76,222,468 H169R probably benign Het
Rad51ap2 T A 12: 11,456,250 S58T possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Slc6a15 T C 10: 103,395,064 S217P probably benign Het
Snx27 G A 3: 94,519,109 T361I probably damaging Het
St7l A G 3: 104,868,047 T80A probably damaging Het
Stk32b T A 5: 37,531,687 M98L possibly damaging Het
Tonsl C A 15: 76,624,150 A6S possibly damaging Het
Tpx2 A G 2: 152,869,691 R49G probably benign Het
Trmt2a A G 16: 18,249,894 K144E possibly damaging Het
Trpm7 A C 2: 126,812,777 L1414V probably benign Het
Ugdh T C 5: 65,423,596 K107E possibly damaging Het
Vamp3 A T 4: 151,050,909 probably benign Het
Vmn1r172 T C 7: 23,660,226 S179P probably damaging Het
Vmn1r28 A G 6: 58,265,978 M269V probably benign Het
Vmn2r94 T C 17: 18,244,214 T605A probably benign Het
Vwce A G 19: 10,638,156 T134A possibly damaging Het
Zfp277 T C 12: 40,445,746 E5G probably benign Het
Other mutations in Nos3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Nos3 APN 5 24369862 missense probably damaging 1.00
IGL02059:Nos3 APN 5 24368998 missense probably damaging 1.00
IGL02354:Nos3 APN 5 24367623 missense probably damaging 1.00
IGL02361:Nos3 APN 5 24367623 missense probably damaging 1.00
IGL02936:Nos3 APN 5 24380993 missense probably damaging 0.97
IGL03190:Nos3 APN 5 24383629 missense probably damaging 1.00
paul UTSW 5 24372704 missense probably damaging 1.00
Peter UTSW 5 24377855 missense probably damaging 0.99
R0111:Nos3 UTSW 5 24372704 missense probably damaging 1.00
R0387:Nos3 UTSW 5 24367585 missense probably damaging 1.00
R0755:Nos3 UTSW 5 24367297 missense probably damaging 1.00
R1156:Nos3 UTSW 5 24377619 missense probably benign 0.21
R1597:Nos3 UTSW 5 24368997 missense probably damaging 1.00
R1671:Nos3 UTSW 5 24383840 missense probably damaging 1.00
R1743:Nos3 UTSW 5 24377312 missense probably benign 0.22
R1830:Nos3 UTSW 5 24370133 missense probably damaging 1.00
R2294:Nos3 UTSW 5 24364857 missense probably damaging 0.99
R3114:Nos3 UTSW 5 24372631 splice site probably benign
R3978:Nos3 UTSW 5 24377931 missense probably damaging 1.00
R3980:Nos3 UTSW 5 24377931 missense probably damaging 1.00
R4016:Nos3 UTSW 5 24371716 missense probably damaging 1.00
R4905:Nos3 UTSW 5 24367331 missense probably benign 0.01
R4947:Nos3 UTSW 5 24377855 missense probably damaging 0.99
R5017:Nos3 UTSW 5 24366719 intron probably benign
R5095:Nos3 UTSW 5 24368918 splice site probably benign
R5096:Nos3 UTSW 5 24371957 missense probably damaging 1.00
R5102:Nos3 UTSW 5 24371627 missense probably damaging 1.00
R5311:Nos3 UTSW 5 24377345 missense probably benign 0.19
R5330:Nos3 UTSW 5 24369904 missense probably damaging 1.00
R5367:Nos3 UTSW 5 24371944 missense probably benign 0.00
R5394:Nos3 UTSW 5 24383890 missense probably benign 0.00
R5574:Nos3 UTSW 5 24368861 missense possibly damaging 0.80
R5889:Nos3 UTSW 5 24368777 intron probably benign
R6032:Nos3 UTSW 5 24379811 missense probably benign
R6032:Nos3 UTSW 5 24379811 missense probably benign
R6401:Nos3 UTSW 5 24379811 missense probably benign
R6517:Nos3 UTSW 5 24383624 missense probably damaging 1.00
R6888:Nos3 UTSW 5 24383335 missense possibly damaging 0.86
R6972:Nos3 UTSW 5 24380243 missense probably benign
X0020:Nos3 UTSW 5 24370124 missense probably damaging 1.00
X0061:Nos3 UTSW 5 24382635 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGGCAAACAAGGCTGTTAG -3'
(R):5'- CTGTTCCAGATCCGGAAGTC -3'

Sequencing Primer
(F):5'- CAAGGCTGTTAGAGGAGGGTC -3'
(R):5'- CACTGTGATGGCTGAACTGACAC -3'
Posted On2014-06-30