Incidental Mutation 'R1882:Nrg2'
ID209210
Institutional Source Beutler Lab
Gene Symbol Nrg2
Ensembl Gene ENSMUSG00000060275
Gene Nameneuregulin 2
SynonymsNTAK, Don1
MMRRC Submission 039903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R1882 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36017707-36197380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36021097 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 589 (D589G)
Ref Sequence ENSEMBL: ENSMUSP00000111378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115713]
Predicted Effect unknown
Transcript: ENSMUST00000115712
AA Change: D403G
SMART Domains Protein: ENSMUSP00000111377
Gene: ENSMUSG00000060275
AA Change: D403G

DomainStartEndE-ValueType
low complexity region 19 66 N/A INTRINSIC
low complexity region 69 111 N/A INTRINSIC
IGc2 259 329 3.85e-14 SMART
EGF 355 393 1.66e-2 SMART
Pfam:Neuregulin 403 834 1.7e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115713
AA Change: D589G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111378
Gene: ENSMUSG00000060275
AA Change: D589G

DomainStartEndE-ValueType
low complexity region 19 66 N/A INTRINSIC
low complexity region 69 111 N/A INTRINSIC
IGc2 259 329 3.85e-14 SMART
EGF 355 393 3.76e-1 SMART
Pfam:Neuregulin 409 844 4.4e-170 PFAM
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel member of the neuregulin family of growth and differentiation factors. Through interaction with the ERBB family of receptors, this protein induces the growth and differentiation of epithelial, neuronal, glial, and other types of cells. The gene consists of 12 exons and the genomic structure is similar to that of neuregulin 1, another member of the neuregulin family of ligands. The products of these genes mediate distinct biological processes by acting at different sites in tissues and eliciting different biological responses in cells. This gene is located close to the region for demyelinating Charcot-Marie-Tooth disease locus, but is not responsible for this disease. Alternative transcript variants encoding distinct isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: About one third of mice homozygous for a knock-out allele die prior to weaning in the absence of cardiac defects or other morphological abnormalities. Homozygotes display an early but transient postnatal growth deficit and reduced reproductive capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,798,506 S189P probably benign Het
Adgrg3 G T 8: 95,040,315 V433F probably benign Het
Arhgap33 A T 7: 30,522,809 W1233R probably damaging Het
Brf2 T C 8: 27,128,549 D9G probably damaging Het
Btrc G A 19: 45,527,400 R562Q probably damaging Het
Cenpu T C 8: 46,556,190 F67L probably damaging Het
Chia1 T C 3: 106,128,474 M150T probably damaging Het
Cntln A G 4: 85,100,835 E1254G probably damaging Het
Creld1 G A 6: 113,492,205 C332Y probably damaging Het
Ctla2a A G 13: 60,935,541 probably benign Het
Dusp13 A T 14: 21,734,975 D223E probably benign Het
Ext1 C A 15: 53,075,792 L620F probably damaging Het
Gm6614 C A 6: 141,993,637 probably null Het
H2-DMb2 C T 17: 34,147,860 R89C probably damaging Het
Klhl32 A T 4: 24,743,916 L17* probably null Het
Lats2 C T 14: 57,697,354 V640M probably damaging Het
Lrig3 G A 10: 126,009,825 V708I possibly damaging Het
Mtcl1 T C 17: 66,379,320 T415A probably benign Het
Mynn A G 3: 30,616,813 *611W probably null Het
Nfx1 A G 4: 41,009,240 T793A possibly damaging Het
Nlrp4d T C 7: 10,382,677 noncoding transcript Het
Nos3 T C 5: 24,368,820 V194A probably damaging Het
Npc1l1 C T 11: 6,217,473 probably null Het
Olfr1008 T A 2: 85,689,606 M59K probably damaging Het
Olfr126 T C 17: 37,850,948 S119P probably damaging Het
Olfr1390 A G 11: 49,340,712 Y60C probably damaging Het
Olfr1418 T C 19: 11,855,471 T161A probably damaging Het
Omg C T 11: 79,501,719 probably benign Het
P2ry2 G T 7: 100,998,851 Y82* probably null Het
Pcdh1 T C 18: 38,202,842 T247A possibly damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pgm3 A G 9: 86,565,690 Y167H possibly damaging Het
Pramef20 A T 4: 144,376,915 C214S probably benign Het
Prmt2 T C 10: 76,222,468 H169R probably benign Het
Rad51ap2 T A 12: 11,456,250 S58T possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Slc6a15 T C 10: 103,395,064 S217P probably benign Het
Snx27 G A 3: 94,519,109 T361I probably damaging Het
St7l A G 3: 104,868,047 T80A probably damaging Het
Stk32b T A 5: 37,531,687 M98L possibly damaging Het
Tonsl C A 15: 76,624,150 A6S possibly damaging Het
Tpx2 A G 2: 152,869,691 R49G probably benign Het
Trmt2a A G 16: 18,249,894 K144E possibly damaging Het
Trpm7 A C 2: 126,812,777 L1414V probably benign Het
Ugdh T C 5: 65,423,596 K107E possibly damaging Het
Vamp3 A T 4: 151,050,909 probably benign Het
Vmn1r172 T C 7: 23,660,226 S179P probably damaging Het
Vmn1r28 A G 6: 58,265,978 M269V probably benign Het
Vmn2r94 T C 17: 18,244,214 T605A probably benign Het
Vwce A G 19: 10,638,156 T134A possibly damaging Het
Zfp277 T C 12: 40,445,746 E5G probably benign Het
Other mutations in Nrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nrg2 APN 18 36021218 missense probably benign 0.00
IGL01396:Nrg2 APN 18 36045852 splice site probably benign
R0179:Nrg2 UTSW 18 36022415 missense probably benign 0.13
R0976:Nrg2 UTSW 18 36021091 missense probably benign 0.21
R1387:Nrg2 UTSW 18 36196739 missense probably damaging 1.00
R1487:Nrg2 UTSW 18 36052912 missense possibly damaging 0.69
R1746:Nrg2 UTSW 18 36021922 missense probably damaging 1.00
R1940:Nrg2 UTSW 18 36196844 unclassified probably benign
R2090:Nrg2 UTSW 18 36018443 missense probably benign 0.00
R2183:Nrg2 UTSW 18 36196751 missense probably benign 0.11
R4664:Nrg2 UTSW 18 36052895 missense possibly damaging 0.87
R4677:Nrg2 UTSW 18 36021099 missense possibly damaging 0.92
R4860:Nrg2 UTSW 18 36196547 missense probably damaging 1.00
R4860:Nrg2 UTSW 18 36196547 missense probably damaging 1.00
R5091:Nrg2 UTSW 18 36052785 missense probably damaging 1.00
R6657:Nrg2 UTSW 18 36196589 missense probably damaging 0.98
R6968:Nrg2 UTSW 18 36196446 missense probably benign 0.01
R7186:Nrg2 UTSW 18 36045920 missense probably benign 0.17
R7304:Nrg2 UTSW 18 36045941 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AATGTTCCCTAATGCCACAAACTG -3'
(R):5'- TTCCCAGACATGAGAGCCAC -3'

Sequencing Primer
(F):5'- ACAAACTGTGTGTTCACTCCAG -3'
(R):5'- ACACGTGGAGCCTGGAAC -3'
Posted On2014-06-30