Incidental Mutation 'R0118:Cic'
ID 20923
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Name capicua transcriptional repressor
Synonyms 1200010B10Rik
MMRRC Submission 038404-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R0118 (G1)
Quality Score 178
Status Validated (trace)
Chromosome 7
Chromosomal Location 24967129-24993584 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24985459 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 301 (S301L)
Ref Sequence ENSEMBL: ENSMUSP00000128071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000165239] [ENSMUST00000169266]
AlphaFold Q924A2
Predicted Effect probably damaging
Transcript: ENSMUST00000005578
AA Change: S301L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: S301L

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1155 N/A INTRINSIC
low complexity region 1223 1253 N/A INTRINSIC
low complexity region 1280 1313 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163320
AA Change: S301L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: S301L

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1064 1079 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
low complexity region 1134 1154 N/A INTRINSIC
low complexity region 1222 1252 N/A INTRINSIC
low complexity region 1279 1312 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164440
Predicted Effect probably damaging
Transcript: ENSMUST00000165239
AA Change: S301L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: S301L

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 5e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167379
Predicted Effect probably damaging
Transcript: ENSMUST00000169266
AA Change: S1208L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: S1208L

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169743
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 89.3%
  • 20x: 67.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T C 9: 30,823,040 (GRCm39) R343G probably damaging Het
Asxl2 T G 12: 3,546,923 (GRCm39) V569G probably damaging Het
Azin2 A C 4: 128,843,430 (GRCm39) H85Q probably damaging Het
Cacna1a C T 8: 85,262,712 (GRCm39) R324C probably damaging Het
Ccr3 C A 9: 123,829,647 (GRCm39) Y327* probably null Het
Cers2 T C 3: 95,227,537 (GRCm39) F55S probably benign Het
Cntnap2 T C 6: 45,037,326 (GRCm39) probably null Het
Cpn2 T C 16: 30,079,186 (GRCm39) R172G probably benign Het
Ctdnep1 T C 11: 69,879,557 (GRCm39) probably null Het
Dennd3 T A 15: 73,436,925 (GRCm39) Y1051N probably damaging Het
Dmap1 T G 4: 117,533,680 (GRCm39) Y196S probably damaging Het
Entpd7 G A 19: 43,692,751 (GRCm39) W102* probably null Het
Frem2 A T 3: 53,442,664 (GRCm39) C2624* probably null Het
Gdpd3 A G 7: 126,370,165 (GRCm39) Y238C probably damaging Het
Gjb3 A G 4: 127,220,451 (GRCm39) V27A probably damaging Het
Kat6b T C 14: 21,720,042 (GRCm39) F1465L probably damaging Het
Klra17 A T 6: 129,808,552 (GRCm39) M227K probably benign Het
Map6 A G 7: 98,966,824 (GRCm39) D348G possibly damaging Het
Mapkbp1 T C 2: 119,855,696 (GRCm39) S1472P probably benign Het
Megf6 C A 4: 154,339,098 (GRCm39) P545Q probably damaging Het
Mertk C T 2: 128,601,086 (GRCm39) R357W probably damaging Het
Mesd T A 7: 83,544,835 (GRCm39) I104N probably damaging Het
Mrm3 T A 11: 76,140,781 (GRCm39) V263E possibly damaging Het
Ndst4 T A 3: 125,405,210 (GRCm39) Y488* probably null Het
Nfat5 C T 8: 108,065,707 (GRCm39) R156W probably damaging Het
Nfs1 T C 2: 155,976,444 (GRCm39) H150R probably damaging Het
Odad3 A T 9: 21,906,353 (GRCm39) N224K probably benign Het
Or1n1b A G 2: 36,780,035 (GRCm39) M275T probably benign Het
Or8b56 T C 9: 38,739,154 (GRCm39) S50P possibly damaging Het
Or8g19 T A 9: 39,055,399 (GRCm39) M1K probably null Het
Or9q1 A G 19: 13,804,929 (GRCm39) F277S possibly damaging Het
Pcdh8 T C 14: 80,004,848 (GRCm39) Y1059C probably damaging Het
Pik3r5 T A 11: 68,381,306 (GRCm39) L164Q probably damaging Het
Polr3g T C 13: 81,824,240 (GRCm39) probably benign Het
Ppm1e T A 11: 87,122,564 (GRCm39) K464N probably benign Het
Rims1 T C 1: 22,416,631 (GRCm39) T1037A probably damaging Het
Rpgrip1l A T 8: 91,996,750 (GRCm39) I108N probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Spem1 T C 11: 69,712,371 (GRCm39) K98E possibly damaging Het
St7l T C 3: 104,796,619 (GRCm39) V237A probably damaging Het
Tbc1d16 T C 11: 119,048,642 (GRCm39) H337R probably damaging Het
Tbc1d32 T A 10: 55,893,701 (GRCm39) I1291F probably benign Het
Tnfaip6 G T 2: 51,933,827 (GRCm39) E61* probably null Het
Trib2 A T 12: 15,843,929 (GRCm39) W102R probably damaging Het
Uimc1 G T 13: 55,233,457 (GRCm39) N66K probably damaging Het
Vmn1r63 T A 7: 5,805,838 (GRCm39) T265S probably benign Het
Vps35 G A 8: 86,021,582 (GRCm39) T3I probably benign Het
Yeats2 T A 16: 19,975,692 (GRCm39) L63* probably null Het
Zfp282 A G 6: 47,869,866 (GRCm39) R304G probably benign Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 24,991,549 (GRCm39) missense probably damaging 1.00
IGL01668:Cic APN 7 24,990,629 (GRCm39) missense possibly damaging 0.47
IGL02229:Cic APN 7 24,990,375 (GRCm39) missense probably damaging 0.96
IGL02506:Cic APN 7 24,990,282 (GRCm39) missense probably benign
IGL02794:Cic APN 7 24,985,069 (GRCm39) missense probably damaging 1.00
IGL03065:Cic APN 7 24,985,246 (GRCm39) splice site probably benign
IGL03304:Cic APN 7 24,984,274 (GRCm39) missense probably damaging 1.00
Capuccino UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
Cassock UTSW 7 24,988,338 (GRCm39) nonsense probably null
Monkey UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R4850_Cic_466 UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
1mM(1):Cic UTSW 7 24,990,214 (GRCm39) splice site probably benign
IGL03046:Cic UTSW 7 24,990,500 (GRCm39) missense probably damaging 1.00
R0012:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0012:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0027:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0027:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0038:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0038:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0063:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0063:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0064:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0064:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0193:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0193:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0241:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0241:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0377:Cic UTSW 7 24,985,224 (GRCm39) missense probably damaging 0.98
R0462:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0462:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0800:Cic UTSW 7 24,984,662 (GRCm39) missense probably benign
R1253:Cic UTSW 7 24,990,373 (GRCm39) missense probably damaging 1.00
R1458:Cic UTSW 7 24,979,162 (GRCm39) intron probably benign
R1462:Cic UTSW 7 24,971,032 (GRCm39) missense probably damaging 0.98
R1462:Cic UTSW 7 24,971,032 (GRCm39) missense probably damaging 0.98
R1519:Cic UTSW 7 24,993,235 (GRCm39) critical splice acceptor site probably null
R1586:Cic UTSW 7 24,985,386 (GRCm39) missense probably damaging 1.00
R1824:Cic UTSW 7 24,987,691 (GRCm39) missense probably damaging 1.00
R1908:Cic UTSW 7 24,986,265 (GRCm39) missense probably damaging 1.00
R2045:Cic UTSW 7 24,970,961 (GRCm39) missense possibly damaging 0.53
R2063:Cic UTSW 7 24,972,876 (GRCm39) missense probably damaging 0.98
R2161:Cic UTSW 7 24,987,559 (GRCm39) splice site probably null
R2495:Cic UTSW 7 24,991,201 (GRCm39) splice site probably benign
R2865:Cic UTSW 7 24,972,646 (GRCm39) missense probably damaging 0.96
R3692:Cic UTSW 7 24,988,338 (GRCm39) nonsense probably null
R3709:Cic UTSW 7 24,986,406 (GRCm39) missense probably damaging 0.99
R3710:Cic UTSW 7 24,986,406 (GRCm39) missense probably damaging 0.99
R3872:Cic UTSW 7 24,971,124 (GRCm39) missense possibly damaging 0.92
R3946:Cic UTSW 7 24,971,771 (GRCm39) missense possibly damaging 0.93
R4199:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4426:Cic UTSW 7 24,993,433 (GRCm39) utr 3 prime probably benign
R4502:Cic UTSW 7 24,987,892 (GRCm39) missense probably damaging 1.00
R4585:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R4586:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R4614:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4664:Cic UTSW 7 24,990,099 (GRCm39) small deletion probably benign
R4688:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4695:Cic UTSW 7 24,973,013 (GRCm39) missense possibly damaging 0.72
R4696:Cic UTSW 7 24,987,908 (GRCm39) missense probably benign
R4746:Cic UTSW 7 24,987,905 (GRCm39) missense probably damaging 1.00
R4758:Cic UTSW 7 24,991,636 (GRCm39) missense possibly damaging 0.62
R4767:Cic UTSW 7 24,971,025 (GRCm39) missense possibly damaging 0.92
R4776:Cic UTSW 7 24,982,308 (GRCm39) missense possibly damaging 0.95
R4820:Cic UTSW 7 24,971,157 (GRCm39) missense possibly damaging 0.92
R4850:Cic UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
R4851:Cic UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
R4922:Cic UTSW 7 24,991,095 (GRCm39) small insertion probably benign
R4989:Cic UTSW 7 24,986,535 (GRCm39) missense probably damaging 1.00
R5131:Cic UTSW 7 24,991,095 (GRCm39) small insertion probably benign
R5718:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R5801:Cic UTSW 7 24,970,863 (GRCm39) missense possibly damaging 0.93
R5949:Cic UTSW 7 24,971,730 (GRCm39) missense probably damaging 1.00
R6000:Cic UTSW 7 24,971,423 (GRCm39) missense probably benign 0.33
R6246:Cic UTSW 7 24,971,067 (GRCm39) missense probably damaging 1.00
R6283:Cic UTSW 7 24,985,459 (GRCm39) missense probably damaging 1.00
R6364:Cic UTSW 7 24,972,248 (GRCm39) missense possibly damaging 0.72
R6481:Cic UTSW 7 24,987,706 (GRCm39) missense possibly damaging 0.56
R6919:Cic UTSW 7 24,971,202 (GRCm39) missense probably benign 0.04
R6920:Cic UTSW 7 24,990,107 (GRCm39) missense probably damaging 1.00
R6995:Cic UTSW 7 24,970,736 (GRCm39) missense possibly damaging 0.53
R7002:Cic UTSW 7 24,971,621 (GRCm39) missense probably damaging 0.99
R7113:Cic UTSW 7 24,972,869 (GRCm39) missense probably benign 0.08
R7560:Cic UTSW 7 24,972,278 (GRCm39) missense probably damaging 0.98
R7680:Cic UTSW 7 24,991,856 (GRCm39) missense probably damaging 0.96
R7698:Cic UTSW 7 24,972,597 (GRCm39) missense possibly damaging 0.72
R7746:Cic UTSW 7 24,988,207 (GRCm39) missense probably damaging 1.00
R7841:Cic UTSW 7 24,985,192 (GRCm39) missense probably damaging 1.00
R7879:Cic UTSW 7 24,984,551 (GRCm39) missense probably benign 0.10
R7916:Cic UTSW 7 24,987,715 (GRCm39) missense probably damaging 0.99
R7920:Cic UTSW 7 24,971,384 (GRCm39) missense probably benign
R8056:Cic UTSW 7 24,990,366 (GRCm39) missense possibly damaging 0.90
R8226:Cic UTSW 7 24,987,213 (GRCm39) missense probably damaging 1.00
R8281:Cic UTSW 7 24,971,249 (GRCm39) missense probably benign
R8847:Cic UTSW 7 24,970,631 (GRCm39) missense probably damaging 0.98
R8991:Cic UTSW 7 24,988,885 (GRCm39) missense probably damaging 1.00
R9083:Cic UTSW 7 24,985,470 (GRCm39) missense probably damaging 0.99
R9140:Cic UTSW 7 24,985,165 (GRCm39) missense probably damaging 0.99
R9200:Cic UTSW 7 24,971,940 (GRCm39) missense probably damaging 0.99
R9208:Cic UTSW 7 24,987,502 (GRCm39) missense probably benign 0.07
R9301:Cic UTSW 7 24,991,117 (GRCm39) missense probably damaging 1.00
R9408:Cic UTSW 7 24,971,414 (GRCm39) missense possibly damaging 0.70
R9569:Cic UTSW 7 24,972,120 (GRCm39) missense possibly damaging 0.85
R9752:Cic UTSW 7 24,971,403 (GRCm39) missense probably damaging 0.96
V7732:Cic UTSW 7 24,991,670 (GRCm39) missense probably benign
Z1176:Cic UTSW 7 24,970,444 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATGATCTTCAGCAAGCGGCACC -3'
(R):5'- CCAGTTCTTTTGTGGACGAGTCCTC -3'

Sequencing Primer
(F):5'- GGACTGTCAGCAAGATCCTG -3'
(R):5'- TTTGTGGACGAGTCCTCAAAAG -3'
Posted On 2013-04-11