Incidental Mutation 'R0118:Cacna1a'
ID20928
Institutional Source Beutler Lab
Gene Symbol Cacna1a
Ensembl Gene ENSMUSG00000034656
Gene Namecalcium channel, voltage-dependent, P/Q type, alpha 1A subunit
SynonymsCacnl1a4, alpha1A, SCA6, nmf352, Ccha1a
MMRRC Submission 038404-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R0118 (G1)
Quality Score220
Status Validated (trace)
Chromosome8
Chromosomal Location84388440-84640246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84536083 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 324 (R324C)
Ref Sequence ENSEMBL: ENSMUSP00000114055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]
Predicted Effect probably damaging
Transcript: ENSMUST00000121390
AA Change: R371C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656
AA Change: R371C

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 99 373 1.5e-69 PFAM
Pfam:Ion_trans 488 727 1.2e-54 PFAM
Pfam:PKD_channel 578 721 6.6e-8 PFAM
low complexity region 920 959 N/A INTRINSIC
low complexity region 977 987 N/A INTRINSIC
low complexity region 1074 1093 N/A INTRINSIC
low complexity region 1143 1168 N/A INTRINSIC
Pfam:Ion_trans 1194 1472 4.9e-64 PFAM
Pfam:Ion_trans 1516 1773 2.8e-64 PFAM
Pfam:GPHH 1775 1844 5.6e-39 PFAM
Ca_chan_IQ 1899 1933 1.8e-12 SMART
AT_hook 2053 2065 2.02e0 SMART
low complexity region 2101 2113 N/A INTRINSIC
low complexity region 2153 2179 N/A INTRINSIC
low complexity region 2213 2236 N/A INTRINSIC
low complexity region 2253 2282 N/A INTRINSIC
low complexity region 2314 2325 N/A INTRINSIC
low complexity region 2342 2357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122053
AA Change: R324C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656
AA Change: R324C

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 91 314 4.5e-58 PFAM
PDB:4DEX|B 317 427 5e-45 PDB
Pfam:Ion_trans 476 668 6.4e-46 PFAM
Pfam:PKD_channel 530 675 7.7e-8 PFAM
low complexity region 873 912 N/A INTRINSIC
low complexity region 930 940 N/A INTRINSIC
low complexity region 1027 1046 N/A INTRINSIC
low complexity region 1096 1121 N/A INTRINSIC
Pfam:Ion_trans 1183 1414 2.8e-54 PFAM
Pfam:Ion_trans 1504 1714 3.2e-60 PFAM
Ca_chan_IQ 1852 1886 1.8e-12 SMART
AT_hook 2006 2018 2.02e0 SMART
low complexity region 2054 2066 N/A INTRINSIC
low complexity region 2106 2132 N/A INTRINSIC
low complexity region 2166 2189 N/A INTRINSIC
low complexity region 2206 2235 N/A INTRINSIC
low complexity region 2267 2278 N/A INTRINSIC
low complexity region 2295 2310 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000215756
AA Change: R324C
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 89.3%
  • 20x: 67.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T C 9: 30,911,744 R343G probably damaging Het
Asxl2 T G 12: 3,496,923 V569G probably damaging Het
Azin2 A C 4: 128,949,637 H85Q probably damaging Het
Ccdc151 A T 9: 21,995,057 N224K probably benign Het
Ccr3 C A 9: 124,029,610 Y327* probably null Het
Cers2 T C 3: 95,320,226 F55S probably benign Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cntnap2 T C 6: 45,060,392 probably null Het
Cpn2 T C 16: 30,260,368 R172G probably benign Het
Ctdnep1 T C 11: 69,988,731 probably null Het
Dennd3 T A 15: 73,565,076 Y1051N probably damaging Het
Dmap1 T G 4: 117,676,483 Y196S probably damaging Het
Entpd7 G A 19: 43,704,312 W102* probably null Het
Frem2 A T 3: 53,535,243 C2624* probably null Het
Gdpd3 A G 7: 126,770,993 Y238C probably damaging Het
Gjb3 A G 4: 127,326,658 V27A probably damaging Het
Kat6b T C 14: 21,669,974 F1465L probably damaging Het
Klra17 A T 6: 129,831,589 M227K probably benign Het
Map6 A G 7: 99,317,617 D348G possibly damaging Het
Mapkbp1 T C 2: 120,025,215 S1472P probably benign Het
Megf6 C A 4: 154,254,641 P545Q probably damaging Het
Mertk C T 2: 128,759,166 R357W probably damaging Het
Mesd T A 7: 83,895,627 I104N probably damaging Het
Mrm3 T A 11: 76,249,955 V263E possibly damaging Het
Ndst4 T A 3: 125,611,561 Y488* probably null Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nfs1 T C 2: 156,134,524 H150R probably damaging Het
Olfr1500 A G 19: 13,827,565 F277S possibly damaging Het
Olfr27 T A 9: 39,144,103 M1K probably null Het
Olfr353 A G 2: 36,890,023 M275T probably benign Het
Olfr923 T C 9: 38,827,858 S50P possibly damaging Het
Pcdh8 T C 14: 79,767,408 Y1059C probably damaging Het
Pik3r5 T A 11: 68,490,480 L164Q probably damaging Het
Polr3g T C 13: 81,676,121 probably benign Het
Ppm1e T A 11: 87,231,738 K464N probably benign Het
Rims1 T C 1: 22,346,407 T1037A probably damaging Het
Rpgrip1l A T 8: 91,270,122 I108N probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Spem1 T C 11: 69,821,545 K98E possibly damaging Het
St7l T C 3: 104,889,303 V237A probably damaging Het
Tbc1d16 T C 11: 119,157,816 H337R probably damaging Het
Tbc1d32 T A 10: 56,017,605 I1291F probably benign Het
Tnfaip6 G T 2: 52,043,815 E61* probably null Het
Trib2 A T 12: 15,793,928 W102R probably damaging Het
Uimc1 G T 13: 55,085,644 N66K probably damaging Het
Vmn1r63 T A 7: 5,802,839 T265S probably benign Het
Vps35 G A 8: 85,294,953 T3I probably benign Het
Yeats2 T A 16: 20,156,942 L63* probably null Het
Zfp282 A G 6: 47,892,932 R304G probably benign Het
Other mutations in Cacna1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Cacna1a APN 8 84571208 nonsense probably null
IGL00513:Cacna1a APN 8 84553056 missense probably damaging 1.00
IGL00569:Cacna1a APN 8 84462714 missense probably damaging 1.00
IGL00981:Cacna1a APN 8 84548553 missense probably damaging 1.00
IGL01122:Cacna1a APN 8 84614793 critical splice donor site probably null
IGL01309:Cacna1a APN 8 84523028 missense probably damaging 1.00
IGL01380:Cacna1a APN 8 84559117 missense probably damaging 1.00
IGL01638:Cacna1a APN 8 84571827 missense probably damaging 0.98
IGL01682:Cacna1a APN 8 84536438 missense possibly damaging 0.71
IGL02751:Cacna1a APN 8 84569952 missense probably damaging 1.00
IGL02904:Cacna1a APN 8 84579520 missense probably damaging 1.00
IGL03122:Cacna1a APN 8 84462676 splice site probably benign
totter UTSW 8 84588753 missense probably damaging 0.99
totter2 UTSW 8 84588753 missense probably damaging 0.99
FR4340:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638714 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4548:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638726 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638726 small insertion probably benign
IGL03134:Cacna1a UTSW 8 84559087 missense probably damaging 1.00
R0055:Cacna1a UTSW 8 84580058 splice site probably benign
R0284:Cacna1a UTSW 8 84612285 missense probably damaging 1.00
R0581:Cacna1a UTSW 8 84601936 missense possibly damaging 0.83
R0607:Cacna1a UTSW 8 84629831 missense probably damaging 1.00
R1168:Cacna1a UTSW 8 84579501 missense probably damaging 1.00
R1183:Cacna1a UTSW 8 84580217 missense probably damaging 1.00
R1470:Cacna1a UTSW 8 84514950 splice site probably benign
R1503:Cacna1a UTSW 8 84601946 missense probably benign 0.23
R1522:Cacna1a UTSW 8 84633433 missense probably benign 0.00
R1835:Cacna1a UTSW 8 84581357 splice site probably null
R1862:Cacna1a UTSW 8 84415930 missense possibly damaging 0.80
R2148:Cacna1a UTSW 8 84629675 missense possibly damaging 0.71
R2237:Cacna1a UTSW 8 84633765 critical splice donor site probably null
R2567:Cacna1a UTSW 8 84549725 missense probably damaging 1.00
R2999:Cacna1a UTSW 8 84567742 missense probably damaging 1.00
R3025:Cacna1a UTSW 8 84580225 critical splice donor site probably null
R3610:Cacna1a UTSW 8 84559065 missense probably damaging 1.00
R3702:Cacna1a UTSW 8 84617846 missense probably damaging 0.98
R3763:Cacna1a UTSW 8 84583642 missense possibly damaging 0.85
R4025:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4026:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4106:Cacna1a UTSW 8 84583695 missense possibly damaging 0.85
R4296:Cacna1a UTSW 8 84559293 missense probably damaging 1.00
R4664:Cacna1a UTSW 8 84601767 nonsense probably null
R4713:Cacna1a UTSW 8 84549514 missense probably damaging 1.00
R5223:Cacna1a UTSW 8 84587195 missense possibly damaging 0.94
R5408:Cacna1a UTSW 8 84549707 missense probably damaging 1.00
R5644:Cacna1a UTSW 8 84462777 missense probably damaging 1.00
R5734:Cacna1a UTSW 8 84583731 missense probably damaging 0.96
R5786:Cacna1a UTSW 8 84415721 unclassified probably benign
R5833:Cacna1a UTSW 8 84518697 missense probably damaging 1.00
R5886:Cacna1a UTSW 8 84523022 missense probably damaging 0.99
R6049:Cacna1a UTSW 8 84638846 missense probably damaging 0.96
R6054:Cacna1a UTSW 8 84556785 missense probably damaging 0.99
R6117:Cacna1a UTSW 8 84614721 missense probably damaging 1.00
R6149:Cacna1a UTSW 8 84569952 missense probably damaging 1.00
R6195:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6233:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6607:Cacna1a UTSW 8 84579492 missense probably damaging 1.00
R6753:Cacna1a UTSW 8 84580205 missense probably damaging 1.00
R6798:Cacna1a UTSW 8 84611602 missense probably damaging 1.00
R6831:Cacna1a UTSW 8 84571231 missense probably damaging 1.00
R6980:Cacna1a UTSW 8 84612285 missense possibly damaging 0.85
R7051:Cacna1a UTSW 8 84629915 missense possibly damaging 0.85
R7270:Cacna1a UTSW 8 84571237 missense probably damaging 1.00
X0022:Cacna1a UTSW 8 84633699 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGAGAACCACTGCCTTTCACTGAAC -3'
(R):5'- TGAAGGACTTTCCAGGGGCTACAG -3'

Sequencing Primer
(F):5'- gattctcctgcctctatcttctg -3'
(R):5'- AGCAACTTGGAGCCTCTTTC -3'
Posted On2013-04-11