Incidental Mutation 'R0118:Rpgrip1l'
ID20930
Institutional Source Beutler Lab
Gene Symbol Rpgrip1l
Ensembl Gene ENSMUSG00000033282
Gene NameRpgrip1-like
SynonymsNphp8, fantom, Ftm, 1700047E16Rik
MMRRC Submission 038404-MU
Accession Numbers

NCBI RefSeq: NM_173431.2; MGI: 1920563

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0118 (G1)
Quality Score191
Status Validated (trace)
Chromosome8
Chromosomal Location91217030-91313262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91270122 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 108 (I108N)
Ref Sequence ENSEMBL: ENSMUSP00000147300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113] [ENSMUST00000209616]
Predicted Effect probably damaging
Transcript: ENSMUST00000047783
AA Change: I710N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282
AA Change: I710N

DomainStartEndE-ValueType
coiled coil region 56 143 N/A INTRINSIC
coiled coil region 196 268 N/A INTRINSIC
coiled coil region 299 371 N/A INTRINSIC
coiled coil region 395 454 N/A INTRINSIC
coiled coil region 520 556 N/A INTRINSIC
Pfam:C2-C2_1 597 738 5.8e-61 PFAM
low complexity region 769 778 N/A INTRINSIC
C2 791 896 1.06e-5 SMART
low complexity region 989 1000 N/A INTRINSIC
low complexity region 1057 1080 N/A INTRINSIC
Blast:C2 1098 1223 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136198
Predicted Effect probably benign
Transcript: ENSMUST00000139113
SMART Domains Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

DomainStartEndE-ValueType
coiled coil region 56 143 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209616
AA Change: I108N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 89.3%
  • 20x: 67.4%
Validation Efficiency 98% (50/51)
MGI Phenotype Strain: 3716208
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T C 9: 30,911,744 R343G probably damaging Het
Asxl2 T G 12: 3,496,923 V569G probably damaging Het
Azin2 A C 4: 128,949,637 H85Q probably damaging Het
Cacna1a C T 8: 84,536,083 R324C probably damaging Het
Ccdc151 A T 9: 21,995,057 N224K probably benign Het
Ccr3 C A 9: 124,029,610 Y327* probably null Het
Cers2 T C 3: 95,320,226 F55S probably benign Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cntnap2 T C 6: 45,060,392 probably null Het
Cpn2 T C 16: 30,260,368 R172G probably benign Het
Ctdnep1 T C 11: 69,988,731 probably null Het
Dennd3 T A 15: 73,565,076 Y1051N probably damaging Het
Dmap1 T G 4: 117,676,483 Y196S probably damaging Het
Entpd7 G A 19: 43,704,312 W102* probably null Het
Frem2 A T 3: 53,535,243 C2624* probably null Het
Gdpd3 A G 7: 126,770,993 Y238C probably damaging Het
Gjb3 A G 4: 127,326,658 V27A probably damaging Het
Kat6b T C 14: 21,669,974 F1465L probably damaging Het
Klra17 A T 6: 129,831,589 M227K probably benign Het
Map6 A G 7: 99,317,617 D348G possibly damaging Het
Mapkbp1 T C 2: 120,025,215 S1472P probably benign Het
Megf6 C A 4: 154,254,641 P545Q probably damaging Het
Mertk C T 2: 128,759,166 R357W probably damaging Het
Mesd T A 7: 83,895,627 I104N probably damaging Het
Mrm3 T A 11: 76,249,955 V263E possibly damaging Het
Ndst4 T A 3: 125,611,561 Y488* probably null Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nfs1 T C 2: 156,134,524 H150R probably damaging Het
Olfr1500 A G 19: 13,827,565 F277S possibly damaging Het
Olfr27 T A 9: 39,144,103 M1K probably null Het
Olfr353 A G 2: 36,890,023 M275T probably benign Het
Olfr923 T C 9: 38,827,858 S50P possibly damaging Het
Pcdh8 T C 14: 79,767,408 Y1059C probably damaging Het
Pik3r5 T A 11: 68,490,480 L164Q probably damaging Het
Polr3g T C 13: 81,676,121 probably benign Het
Ppm1e T A 11: 87,231,738 K464N probably benign Het
Rims1 T C 1: 22,346,407 T1037A probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Spem1 T C 11: 69,821,545 K98E possibly damaging Het
St7l T C 3: 104,889,303 V237A probably damaging Het
Tbc1d16 T C 11: 119,157,816 H337R probably damaging Het
Tbc1d32 T A 10: 56,017,605 I1291F probably benign Het
Tnfaip6 G T 2: 52,043,815 E61* probably null Het
Trib2 A T 12: 15,793,928 W102R probably damaging Het
Uimc1 G T 13: 55,085,644 N66K probably damaging Het
Vmn1r63 T A 7: 5,802,839 T265S probably benign Het
Vps35 G A 8: 85,294,953 T3I probably benign Het
Yeats2 T A 16: 20,156,942 L63* probably null Het
Zfp282 A G 6: 47,892,932 R304G probably benign Het
Other mutations in Rpgrip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rpgrip1l APN 8 91263574 missense possibly damaging 0.52
IGL00932:Rpgrip1l APN 8 91275637 missense probably benign 0.33
IGL01113:Rpgrip1l APN 8 91260739 intron probably benign
IGL01151:Rpgrip1l APN 8 91275149 missense probably damaging 1.00
IGL01321:Rpgrip1l APN 8 91260873 nonsense probably null
IGL01384:Rpgrip1l APN 8 91273640 missense probably benign 0.00
IGL01634:Rpgrip1l APN 8 91252543 missense probably benign
IGL01634:Rpgrip1l APN 8 91252544 missense probably benign 0.25
IGL01781:Rpgrip1l APN 8 91270218 missense probably benign 0.16
IGL01784:Rpgrip1l APN 8 91270461 missense possibly damaging 0.56
IGL02034:Rpgrip1l APN 8 91251148 critical splice donor site probably null
IGL02250:Rpgrip1l APN 8 91232861 missense probably benign 0.00
IGL02285:Rpgrip1l APN 8 91232907 missense possibly damaging 0.92
IGL02634:Rpgrip1l APN 8 91225344 splice site probably benign
IGL02736:Rpgrip1l APN 8 91263591 missense possibly damaging 0.91
IGL02825:Rpgrip1l APN 8 91304805 missense probably damaging 0.99
IGL02962:Rpgrip1l APN 8 91270362 missense possibly damaging 0.95
IGL03031:Rpgrip1l APN 8 91260783 missense probably damaging 1.00
IGL03184:Rpgrip1l APN 8 91300809 missense probably damaging 1.00
P0005:Rpgrip1l UTSW 8 91299225 splice site probably benign
R0490:Rpgrip1l UTSW 8 91299845 splice site probably benign
R0599:Rpgrip1l UTSW 8 91305000 missense probably damaging 1.00
R1514:Rpgrip1l UTSW 8 91260750 missense probably damaging 1.00
R1648:Rpgrip1l UTSW 8 91252889 missense probably damaging 1.00
R1914:Rpgrip1l UTSW 8 91232924 missense probably benign 0.13
R1915:Rpgrip1l UTSW 8 91232924 missense probably benign 0.13
R2093:Rpgrip1l UTSW 8 91270132 missense possibly damaging 0.87
R2225:Rpgrip1l UTSW 8 91221467 missense probably benign 0.45
R2504:Rpgrip1l UTSW 8 91280716 critical splice donor site probably null
R3859:Rpgrip1l UTSW 8 91263658 missense probably benign 0.00
R4118:Rpgrip1l UTSW 8 91252907 missense probably benign
R4801:Rpgrip1l UTSW 8 91270177 missense probably damaging 1.00
R4802:Rpgrip1l UTSW 8 91270177 missense probably damaging 1.00
R4921:Rpgrip1l UTSW 8 91261009 missense probably benign 0.05
R4976:Rpgrip1l UTSW 8 91280816 missense probably damaging 1.00
R5092:Rpgrip1l UTSW 8 91221384 nonsense probably null
R5099:Rpgrip1l UTSW 8 91248722 missense probably benign 0.20
R5119:Rpgrip1l UTSW 8 91280816 missense probably damaging 1.00
R5141:Rpgrip1l UTSW 8 91260918 missense probably benign 0.29
R5793:Rpgrip1l UTSW 8 91260772 missense probably benign 0.06
R5847:Rpgrip1l UTSW 8 91304985 missense probably damaging 1.00
R5871:Rpgrip1l UTSW 8 91221386 missense possibly damaging 0.89
R5916:Rpgrip1l UTSW 8 91252913 missense possibly damaging 0.93
R6619:Rpgrip1l UTSW 8 91232871 missense possibly damaging 0.69
R6654:Rpgrip1l UTSW 8 91220205 missense probably benign 0.36
R6984:Rpgrip1l UTSW 8 91260798 missense probably benign 0.03
Z1088:Rpgrip1l UTSW 8 91220179 makesense probably null
Z1088:Rpgrip1l UTSW 8 91260975 missense possibly damaging 0.96
Z1088:Rpgrip1l UTSW 8 91270120 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGAGGAAAGATCACTGTCCCTACCC -3'
(R):5'- TGCAGCCCAGTTAAAGGATATTGCC -3'

Sequencing Primer
(F):5'- CCCAAAATGCCCTTAATGTGTGAG -3'
(R):5'- GGATATTGCCTATGGCACTAAGC -3'
Posted On2013-04-11