Incidental Mutation 'R1883:Tlr7'
ID209321
Institutional Source Beutler Lab
Gene Symbol Tlr7
Ensembl Gene ENSMUSG00000044583
Gene Nametoll-like receptor 7
SynonymsRP23-139P21.3
MMRRC Submission 039904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R1883 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location167304929-167330558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 167306472 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 673 (G673S)
Ref Sequence ENSEMBL: ENSMUSP00000107789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060719] [ENSMUST00000112161] [ENSMUST00000112164] [ENSMUST00000137492] [ENSMUST00000145284]
Predicted Effect probably benign
Transcript: ENSMUST00000060719
AA Change: G673S

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061853
Gene: ENSMUSG00000044583
AA Change: G673S

DomainStartEndE-ValueType
LRRNT 35 69 5.03e-1 SMART
LRR 126 149 2.45e0 SMART
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
LRR 396 419 9.22e0 SMART
LRR 497 516 1.09e2 SMART
LRR 542 565 4.97e0 SMART
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
Pfam:LRR_7 676 692 7.2e-2 PFAM
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 894 1033 4.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112161
AA Change: G673S

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107787
Gene: ENSMUSG00000044583
AA Change: G673S

DomainStartEndE-ValueType
LRRNT 35 69 5.03e-1 SMART
LRR 126 149 2.45e0 SMART
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
LRR 396 419 9.22e0 SMART
LRR 497 516 1.09e2 SMART
LRR 542 565 4.97e0 SMART
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
Pfam:LRR_7 676 692 7.2e-2 PFAM
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 894 1033 4.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112164
AA Change: G673S

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107789
Gene: ENSMUSG00000044583
AA Change: G673S

DomainStartEndE-ValueType
LRRNT 35 69 5.03e-1 SMART
LRR 126 149 2.45e0 SMART
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
LRR 396 419 9.22e0 SMART
LRR 497 516 1.09e2 SMART
LRR 542 565 4.97e0 SMART
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 891 1049 1.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137492
Predicted Effect probably benign
Transcript: ENSMUST00000145284
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung, placenta, and spleen, and lies in close proximity to another family member, TLR8, on chromosome X. [provided by RefSeq, Jul 2008]
PHENOTYPE: The innate immune response to viral infection is affected in homozygous null mice. Mice homozygous or hemizygous for a point mutation produce little or no tumor necrosis factor (TNF) alpha in response to stimulation by a single stranded RNA analog. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,453 T339A probably benign Het
Ano9 T C 7: 141,102,331 E677G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Capn9 A G 8: 124,611,558 K552R probably benign Het
Catsperg1 C T 7: 29,182,236 probably null Het
Cdc16 A G 8: 13,775,738 N449D probably damaging Het
Cdyl2 A T 8: 116,595,163 N208K probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Crybg2 C A 4: 134,074,283 S918* probably null Het
Dact2 A T 17: 14,197,823 S207T possibly damaging Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx18 C A 1: 121,567,916 probably benign Het
Dis3 A T 14: 99,091,469 H282Q probably benign Het
Dnah3 T C 7: 120,077,919 D453G probably benign Het
Dst T C 1: 34,189,308 V1994A possibly damaging Het
Dusp8 C T 7: 142,084,348 probably null Het
Eipr1 A T 12: 28,766,851 H69L possibly damaging Het
Eml1 A G 12: 108,463,652 R65G probably damaging Het
Epha7 C T 4: 28,950,362 H722Y possibly damaging Het
Epyc A T 10: 97,675,833 K229N possibly damaging Het
Extl1 A G 4: 134,364,606 I312T probably benign Het
F13a1 G C 13: 36,989,007 A133G probably benign Het
Fam185a G T 5: 21,425,244 C26F possibly damaging Het
Fam186b T C 15: 99,278,798 N737S probably damaging Het
Fam78b A G 1: 167,001,602 I13V probably benign Het
Fat1 A T 8: 45,051,147 Q4559L probably benign Het
Fnip1 T C 11: 54,515,547 S1157P probably damaging Het
Foxj3 A C 4: 119,610,029 M190L probably benign Het
Gm5096 T C 18: 87,756,545 L64P probably damaging Het
Heatr3 T C 8: 88,144,593 Y192H possibly damaging Het
Hexdc T A 11: 121,207,698 S3T probably benign Het
Klf3 C T 5: 64,822,881 P5S probably damaging Het
Klf9 C T 19: 23,164,737 S187L probably damaging Het
Krt9 T C 11: 100,188,697 H623R unknown Het
Krtap2-4 G C 11: 99,614,679 C35W probably benign Het
Lmtk3 T C 7: 45,786,849 Y84H probably damaging Het
Mroh3 G T 1: 136,206,993 A166D probably damaging Het
Musk C A 4: 58,373,189 P697T probably benign Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nipbl A C 15: 8,327,132 F1590C probably damaging Het
Nrk G T X: 139,007,173 V1455F probably damaging Het
Nsun3 T C 16: 62,735,293 D290G probably damaging Het
Obscn T C 11: 59,078,203 T222A probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Olfr6 T C 7: 106,956,774 H54R probably benign Het
Osbpl11 T G 16: 33,214,353 H237Q probably benign Het
Pde10a A T 17: 8,978,944 T671S possibly damaging Het
Pkd2 A T 5: 104,483,228 N506I probably damaging Het
Ppp3cb A G 14: 20,523,845 V274A possibly damaging Het
Prex1 T C 2: 166,583,272 D938G probably benign Het
Ptch1 G A 13: 63,512,027 Q1271* probably null Het
Rasgrf2 A G 13: 91,969,030 V820A probably benign Het
Rimbp2 C T 5: 128,803,934 V137M possibly damaging Het
Rpa1 A G 11: 75,318,483 V158A probably benign Het
Rps6ka1 A C 4: 133,864,043 I321S probably damaging Het
Scn3b A C 9: 40,279,373 probably null Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Snx14 T A 9: 88,402,261 E451D probably benign Het
Swt1 T A 1: 151,423,533 K10* probably null Het
Tas1r3 G T 4: 155,862,153 P332T probably damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tecpr1 A G 5: 144,206,529 V676A probably benign Het
Tg A G 15: 66,671,309 E24G probably damaging Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Trabd A G 15: 89,081,981 E47G probably damaging Het
Trim29 T A 9: 43,311,405 I177N probably damaging Het
Ubxn2a A T 12: 4,894,563 L53* probably null Het
Ulk2 A G 11: 61,830,612 L208P probably damaging Het
Unc80 G A 1: 66,525,770 C872Y possibly damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vmn1r20 C A 6: 57,432,321 H211N probably benign Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps54 A T 11: 21,312,967 T685S possibly damaging Het
Vwa5b1 A G 4: 138,575,389 W932R probably damaging Het
Wdr53 A T 16: 32,256,498 I174F possibly damaging Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp60 T C 7: 27,750,010 L701P probably benign Het
Zfp609 A T 9: 65,794,758 M204K probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Zfp995 A T 17: 21,880,641 I204N probably benign Het
Zp2 C T 7: 120,133,401 D641N probably benign Het
Other mutations in Tlr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Tlr7 APN X 167308475 unclassified possibly damaging 0.94
IGL01064:Tlr7 APN X 167308211 unclassified probably damaging 1.00
IGL02940:Tlr7 APN X 167307834 unclassified probably benign 0.02
IGL03064:Tlr7 APN X 167306207 unclassified possibly damaging 0.89
IGL03298:Tlr7 APN X 167306707 unclassified probably benign 0.45
rsq1 UTSW X 167308286 missense probably damaging 1.00
rsq2 UTSW X 167307945 missense probably damaging 0.98
rsq3 UTSW X 167307945 missense probably damaging 0.98
R1400:Tlr7 UTSW X 167307849 missense probably damaging 1.00
R5929:Tlr7 UTSW X 167306882 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGCAATTGCAAAGCATCTTC -3'
(R):5'- GACCATGGAAAGTGACTCTCTTCG -3'

Sequencing Primer
(F):5'- TGCTTAAGAATCAGTGTTGTGAGAC -3'
(R):5'- AAGTGACTCTCTTCGAATTCTGGAG -3'
Posted On2014-06-30