Incidental Mutation 'R1884:Tbck'
ID209332
Institutional Source Beutler Lab
Gene Symbol Tbck
Ensembl Gene ENSMUSG00000028030
Gene NameTBC1 domain containing kinase
SynonymsA630047E20Rik, C030007I09Rik, 1700120J03Rik
MMRRC Submission 039905-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R1884 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location132684144-132841688 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 132724916 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169172]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000029664
SMART Domains Protein: ENSMUSP00000029664
Gene: ENSMUSG00000028030

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 270 6.2e-30 PFAM
Pfam:Pkinase 33 273 1.9e-39 PFAM
Pfam:Kinase-like 71 261 3.4e-8 PFAM
Blast:TBC 366 450 5e-34 BLAST
TBC 463 674 5.27e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169172
SMART Domains Protein: ENSMUSP00000129205
Gene: ENSMUSG00000028030

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 270 4.5e-29 PFAM
Pfam:Pkinase 32 273 1.4e-39 PFAM
Blast:TBC 366 450 5e-34 BLAST
TBC 463 674 5.27e-46 SMART
RHOD 780 886 2.67e-13 SMART
Meta Mutation Damage Score 0.598 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a protein kinase domain, a Rhodanase-like domain and the Tre-2/Bub2/Cdc16 (TBC) domain. The encoded protein is thought to play a role in actin organization, cell growth and cell proliferation by regulating the mammalian target of the rapamycin (mTOR) signaling pathway. This protein may also be involved in the transcriptional regulation of the components of the mTOR complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T C 9: 104,114,485 M573T probably benign Het
Ank3 A G 10: 70,015,592 T1162A possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arpp21 T A 9: 112,143,527 D232V probably damaging Het
Atg2a T C 19: 6,254,384 Y1144H probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Cenpf C T 1: 189,646,849 V2915I probably benign Het
Cep170 G T 1: 176,774,679 T287K probably benign Het
Chst2 G A 9: 95,405,558 T245I probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Coro7 G T 16: 4,628,819 probably benign Het
Cpne8 C A 15: 90,648,628 probably benign Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx31 T A 2: 28,858,990 I266N probably damaging Het
Dnah7a A T 1: 53,541,000 I1592N probably damaging Het
Dok6 A T 18: 89,474,006 L149Q probably damaging Het
Eri2 G A 7: 119,791,123 T94I probably benign Het
Ermp1 A G 19: 29,616,679 V697A probably benign Het
Foxc1 C T 13: 31,807,665 T153M probably damaging Het
Fry A G 5: 150,403,520 I1224V probably benign Het
Fzd5 G A 1: 64,735,654 T316M probably damaging Het
Gcm1 G T 9: 78,059,579 V27L probably benign Het
Gm5773 A T 3: 93,774,041 D340V probably benign Het
Gucy2d T A 7: 98,451,608 H379Q probably benign Het
Hectd1 T A 12: 51,800,955 M392L probably benign Het
Itpr2 A C 6: 146,385,971 D452E probably benign Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lrit1 T C 14: 37,061,753 V346A possibly damaging Het
Lrrk1 A G 7: 66,262,437 S1792P probably benign Het
Marveld2 A T 13: 100,600,621 V168E probably benign Het
Ms4a4b T A 19: 11,461,265 D149E probably damaging Het
Myom2 G A 8: 15,114,278 D1058N probably benign Het
Ncam2 C T 16: 81,437,683 P142L probably damaging Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nol10 T C 12: 17,368,389 probably null Het
Nrcam T C 12: 44,544,755 V194A probably damaging Het
Nudt6 A G 3: 37,412,400 V82A probably benign Het
Odf2l A T 3: 145,151,048 N492I probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Pkn3 T C 2: 30,082,828 V276A probably damaging Het
Prl3b1 T G 13: 27,247,903 L137R possibly damaging Het
Rab11fip2 A G 19: 59,937,330 F10L probably damaging Het
Rab3b T A 4: 108,929,452 V133E probably damaging Het
Rnf111 A T 9: 70,476,238 S138T probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Runx1t1 A G 4: 13,835,767 T75A probably benign Het
Ryr2 T G 13: 11,738,356 K1693T probably damaging Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Setd2 T G 9: 110,556,418 probably null Het
Sh3tc2 A G 18: 62,008,575 Y1109C probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc22a2 A G 17: 12,614,826 probably benign Het
Slc35f4 A T 14: 49,313,634 W108R probably damaging Het
Slc4a1ap A G 5: 31,534,180 E440G probably damaging Het
Slc6a4 A G 11: 77,013,375 T219A probably benign Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Svil T G 18: 5,094,640 V1440G possibly damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Top1mt C T 15: 75,667,901 R287H possibly damaging Het
Trdn A G 10: 33,257,095 K314E probably benign Het
Troap T A 15: 99,077,898 C233S probably benign Het
Usp28 T C 9: 49,035,947 M571T probably damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vipr1 C T 9: 121,665,864 P327L possibly damaging Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn1r69 G A 7: 10,580,751 R18W probably benign Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps13b A T 15: 35,430,291 probably benign Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp385c A C 11: 100,630,706 V176G probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Other mutations in Tbck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Tbck APN 3 132743093 splice site probably null
IGL00492:Tbck APN 3 132722740 missense probably benign 0.00
IGL01020:Tbck APN 3 132727142 nonsense probably null
IGL01111:Tbck APN 3 132694407 missense probably damaging 1.00
IGL01299:Tbck APN 3 132724877 missense probably damaging 0.98
IGL02456:Tbck APN 3 132734714 splice site probably benign
IGL02554:Tbck APN 3 132751192 nonsense probably null
IGL02640:Tbck APN 3 132774486 missense probably benign 0.26
IGL02960:Tbck APN 3 132722783 missense probably benign 0.01
IGL03184:Tbck APN 3 132736103 missense probably damaging 1.00
IGL03246:Tbck APN 3 132774570 missense probably benign
fear-4 UTSW 3 132724916 critical splice donor site probably null
fuerchte UTSW 3 132722291 splice site probably benign
PIT1430001:Tbck UTSW 3 132722726 missense probably benign
PIT4802001:Tbck UTSW 3 132752666 missense probably damaging 1.00
R0113:Tbck UTSW 3 132743080 missense probably damaging 1.00
R0241:Tbck UTSW 3 132724875 missense probably benign
R0241:Tbck UTSW 3 132724875 missense probably benign
R0309:Tbck UTSW 3 132734407 nonsense probably null
R0375:Tbck UTSW 3 132751232 splice site probably benign
R0571:Tbck UTSW 3 132752642 missense probably damaging 1.00
R0831:Tbck UTSW 3 132722291 splice site probably benign
R1135:Tbck UTSW 3 132732191 missense probably damaging 0.97
R1184:Tbck UTSW 3 132837972 missense probably benign 0.01
R1560:Tbck UTSW 3 132838048 missense probably damaging 1.00
R1563:Tbck UTSW 3 132715693 missense possibly damaging 0.94
R1659:Tbck UTSW 3 132734355 missense probably damaging 1.00
R1799:Tbck UTSW 3 132774502 missense probably benign 0.01
R1830:Tbck UTSW 3 132838011 missense probably benign 0.40
R3406:Tbck UTSW 3 132727084 missense probably benign 0.41
R4021:Tbck UTSW 3 132727134 missense probably damaging 0.97
R4205:Tbck UTSW 3 132838028 missense probably benign 0.32
R4503:Tbck UTSW 3 132751220 missense probably benign 0.03
R4794:Tbck UTSW 3 132686968 missense possibly damaging 0.90
R4795:Tbck UTSW 3 132707798 missense possibly damaging 0.95
R4859:Tbck UTSW 3 132801527 missense probably benign 0.00
R5282:Tbck UTSW 3 132751216 missense possibly damaging 0.95
R5787:Tbck UTSW 3 132737568 missense probably damaging 1.00
R5987:Tbck UTSW 3 132801517 missense possibly damaging 0.53
R6145:Tbck UTSW 3 132732215 missense probably damaging 1.00
R6147:Tbck UTSW 3 132694446 missense probably benign
R6242:Tbck UTSW 3 132694428 missense probably benign 0.16
R6276:Tbck UTSW 3 132743005 missense probably damaging 1.00
R6912:Tbck UTSW 3 132686942 missense possibly damaging 0.50
R7107:Tbck UTSW 3 132722331 missense possibly damaging 0.73
X0018:Tbck UTSW 3 132686800 start codon destroyed probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAATGTCAGCTGTTACTAGTATCAG -3'
(R):5'- AGTTTCTCCTGACAAGCCTG -3'

Sequencing Primer
(F):5'- TCAGCTATTAATATAGACACAAACGG -3'
(R):5'- TACAGGGGTTTCCTAAGACCATCAG -3'
Posted On2014-06-30