Incidental Mutation 'R1884:Sik3'
ID209355
Institutional Source Beutler Lab
Gene Symbol Sik3
Ensembl Gene ENSMUSG00000034135
Gene NameSIK family kinase 3
Synonyms
MMRRC Submission 039905-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1884 (G1)
Quality Score131
Status Validated
Chromosome9
Chromosomal Location46012820-46224194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 46221089 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1276 (H1276Q)
Ref Sequence ENSEMBL: ENSMUSP00000112749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120463] [ENSMUST00000126865]
Predicted Effect unknown
Transcript: ENSMUST00000120247
AA Change: H1170Q
SMART Domains Protein: ENSMUSP00000112859
Gene: ENSMUSG00000034135
AA Change: H1170Q

DomainStartEndE-ValueType
S_TKc 19 270 5.4e-102 SMART
internal_repeat_1 349 392 8.97e-6 PROSPERO
low complexity region 436 445 N/A INTRINSIC
internal_repeat_1 492 536 8.97e-6 PROSPERO
low complexity region 602 613 N/A INTRINSIC
low complexity region 628 648 N/A INTRINSIC
low complexity region 682 693 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120463
AA Change: H1276Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000112749
Gene: ENSMUSG00000034135
AA Change: H1276Q

DomainStartEndE-ValueType
low complexity region 1 53 N/A INTRINSIC
S_TKc 64 315 5.4e-102 SMART
low complexity region 529 538 N/A INTRINSIC
low complexity region 647 658 N/A INTRINSIC
low complexity region 673 693 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
low complexity region 830 843 N/A INTRINSIC
low complexity region 894 907 N/A INTRINSIC
low complexity region 996 1011 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126865
AA Change: H1326Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121032
Gene: ENSMUSG00000034135
AA Change: H1326Q

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
S_TKc 66 317 5.4e-102 SMART
internal_repeat_1 444 487 1.55e-6 PROSPERO
low complexity region 531 540 N/A INTRINSIC
internal_repeat_1 587 631 1.55e-6 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 723 743 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 880 893 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1046 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153152
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 99% (94/95)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired chondrocyte hypertrophy during development, neonatal lethality and reduced size. Mice homozygous for a gain of function ENU mutation exhibit decreased total wake time, owing to an increase in inherent sleep need. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T C 9: 104,114,485 M573T probably benign Het
Ank3 A G 10: 70,015,592 T1162A possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arpp21 T A 9: 112,143,527 D232V probably damaging Het
Atg2a T C 19: 6,254,384 Y1144H probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Cenpf C T 1: 189,646,849 V2915I probably benign Het
Cep170 G T 1: 176,774,679 T287K probably benign Het
Chst2 G A 9: 95,405,558 T245I probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Coro7 G T 16: 4,628,819 probably benign Het
Cpne8 C A 15: 90,648,628 probably benign Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx31 T A 2: 28,858,990 I266N probably damaging Het
Dnah7a A T 1: 53,541,000 I1592N probably damaging Het
Dok6 A T 18: 89,474,006 L149Q probably damaging Het
Eri2 G A 7: 119,791,123 T94I probably benign Het
Ermp1 A G 19: 29,616,679 V697A probably benign Het
Foxc1 C T 13: 31,807,665 T153M probably damaging Het
Fry A G 5: 150,403,520 I1224V probably benign Het
Fzd5 G A 1: 64,735,654 T316M probably damaging Het
Gcm1 G T 9: 78,059,579 V27L probably benign Het
Gm5773 A T 3: 93,774,041 D340V probably benign Het
Gucy2d T A 7: 98,451,608 H379Q probably benign Het
Hectd1 T A 12: 51,800,955 M392L probably benign Het
Itpr2 A C 6: 146,385,971 D452E probably benign Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lrit1 T C 14: 37,061,753 V346A possibly damaging Het
Lrrk1 A G 7: 66,262,437 S1792P probably benign Het
Marveld2 A T 13: 100,600,621 V168E probably benign Het
Ms4a4b T A 19: 11,461,265 D149E probably damaging Het
Myom2 G A 8: 15,114,278 D1058N probably benign Het
Ncam2 C T 16: 81,437,683 P142L probably damaging Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nol10 T C 12: 17,368,389 probably null Het
Nrcam T C 12: 44,544,755 V194A probably damaging Het
Nudt6 A G 3: 37,412,400 V82A probably benign Het
Odf2l A T 3: 145,151,048 N492I probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Pkn3 T C 2: 30,082,828 V276A probably damaging Het
Prl3b1 T G 13: 27,247,903 L137R possibly damaging Het
Rab11fip2 A G 19: 59,937,330 F10L probably damaging Het
Rab3b T A 4: 108,929,452 V133E probably damaging Het
Rnf111 A T 9: 70,476,238 S138T probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Runx1t1 A G 4: 13,835,767 T75A probably benign Het
Ryr2 T G 13: 11,738,356 K1693T probably damaging Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Setd2 T G 9: 110,556,418 probably null Het
Sh3tc2 A G 18: 62,008,575 Y1109C probably damaging Het
Slc22a2 A G 17: 12,614,826 probably benign Het
Slc35f4 A T 14: 49,313,634 W108R probably damaging Het
Slc4a1ap A G 5: 31,534,180 E440G probably damaging Het
Slc6a4 A G 11: 77,013,375 T219A probably benign Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Svil T G 18: 5,094,640 V1440G possibly damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tbck T C 3: 132,724,916 probably null Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Top1mt C T 15: 75,667,901 R287H possibly damaging Het
Trdn A G 10: 33,257,095 K314E probably benign Het
Troap T A 15: 99,077,898 C233S probably benign Het
Usp28 T C 9: 49,035,947 M571T probably damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vipr1 C T 9: 121,665,864 P327L possibly damaging Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn1r69 G A 7: 10,580,751 R18W probably benign Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps13b A T 15: 35,430,291 probably benign Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp385c A C 11: 100,630,706 V176G probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Other mutations in Sik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Sik3 APN 9 46211726 missense probably benign 0.37
IGL02957:Sik3 APN 9 46195845 missense possibly damaging 0.90
IGL03052:Sik3 UTSW 9 46198149 missense probably damaging 0.97
PIT4515001:Sik3 UTSW 9 46208731 missense probably damaging 1.00
R0119:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0299:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0344:Sik3 UTSW 9 46208811 missense probably damaging 0.97
R0411:Sik3 UTSW 9 46208770 missense probably damaging 0.99
R0499:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0745:Sik3 UTSW 9 46198239 missense probably benign 0.10
R1017:Sik3 UTSW 9 46195809 missense probably benign 0.00
R1310:Sik3 UTSW 9 46219426 missense possibly damaging 0.81
R1355:Sik3 UTSW 9 46195872 critical splice donor site probably benign
R1406:Sik3 UTSW 9 46123345 splice site probably benign
R1457:Sik3 UTSW 9 46221148 missense probably damaging 1.00
R1497:Sik3 UTSW 9 46202022 missense probably damaging 1.00
R1497:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1852:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1883:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1903:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1918:Sik3 UTSW 9 46221089 missense probably benign 0.00
R2077:Sik3 UTSW 9 46219503 missense probably damaging 1.00
R2379:Sik3 UTSW 9 46155409 missense probably damaging 1.00
R3791:Sik3 UTSW 9 46194822 missense possibly damaging 0.94
R3809:Sik3 UTSW 9 46219486 missense probably benign 0.05
R3955:Sik3 UTSW 9 46198593 missense probably damaging 1.00
R3980:Sik3 UTSW 9 46202063 missense probably damaging 1.00
R4753:Sik3 UTSW 9 46198214 missense probably damaging 0.99
R5195:Sik3 UTSW 9 46208844 critical splice donor site probably null
R5256:Sik3 UTSW 9 46212254 missense probably damaging 0.99
R5432:Sik3 UTSW 9 46123241 missense probably benign 0.45
R5985:Sik3 UTSW 9 46211675 missense probably damaging 1.00
R6310:Sik3 UTSW 9 46178486 missense probably damaging 1.00
R6540:Sik3 UTSW 9 46212053 missense probably benign
R6732:Sik3 UTSW 9 46212553 missense probably benign 0.02
R6812:Sik3 UTSW 9 46210769 missense probably damaging 1.00
R7069:Sik3 UTSW 9 46210743 missense probably damaging 1.00
X0017:Sik3 UTSW 9 46212499 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTCCCTAACATCTGAAGGG -3'
(R):5'- CGCTCAAGTTTAGTGGGGTAC -3'

Sequencing Primer
(F):5'- TAACATCTGAAGGGCCTGCTG -3'
(R):5'- CACATTGAGGCTATGAGGGGC -3'
Posted On2014-06-30