Incidental Mutation 'R1884:Trdn'
ID209366
Institutional Source Beutler Lab
Gene Symbol Trdn
Ensembl Gene ENSMUSG00000019787
Gene Nametriadin
Synonymstriadin-2, triadin 2, triadin 1, triadin 3, EG432451, 2310045H21Rik, triadin-1, triadin-3
MMRRC Submission 039905-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1884 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location33080554-33476709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33257095 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 314 (K314E)
Ref Sequence ENSEMBL: ENSMUSP00000093436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095762]
Predicted Effect probably benign
Transcript: ENSMUST00000095762
AA Change: K314E

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093436
Gene: ENSMUSG00000019787
AA Change: K314E

DomainStartEndE-ValueType
SCOP:d1lnqa2 49 116 1e-4 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 166 182 N/A INTRINSIC
low complexity region 198 223 N/A INTRINSIC
low complexity region 229 250 N/A INTRINSIC
coiled coil region 306 333 N/A INTRINSIC
low complexity region 342 352 N/A INTRINSIC
low complexity region 380 396 N/A INTRINSIC
coiled coil region 417 437 N/A INTRINSIC
low complexity region 448 484 N/A INTRINSIC
low complexity region 539 551 N/A INTRINSIC
low complexity region 559 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217716
Predicted Effect unknown
Transcript: ENSMUST00000219211
AA Change: K118E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219691
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a loss of transverse orientation of triads within skeletal muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T C 9: 104,114,485 M573T probably benign Het
Ank3 A G 10: 70,015,592 T1162A possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arpp21 T A 9: 112,143,527 D232V probably damaging Het
Atg2a T C 19: 6,254,384 Y1144H probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Cenpf C T 1: 189,646,849 V2915I probably benign Het
Cep170 G T 1: 176,774,679 T287K probably benign Het
Chst2 G A 9: 95,405,558 T245I probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Coro7 G T 16: 4,628,819 probably benign Het
Cpne8 C A 15: 90,648,628 probably benign Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx31 T A 2: 28,858,990 I266N probably damaging Het
Dnah7a A T 1: 53,541,000 I1592N probably damaging Het
Dok6 A T 18: 89,474,006 L149Q probably damaging Het
Eri2 G A 7: 119,791,123 T94I probably benign Het
Ermp1 A G 19: 29,616,679 V697A probably benign Het
Foxc1 C T 13: 31,807,665 T153M probably damaging Het
Fry A G 5: 150,403,520 I1224V probably benign Het
Fzd5 G A 1: 64,735,654 T316M probably damaging Het
Gcm1 G T 9: 78,059,579 V27L probably benign Het
Gm5773 A T 3: 93,774,041 D340V probably benign Het
Gucy2d T A 7: 98,451,608 H379Q probably benign Het
Hectd1 T A 12: 51,800,955 M392L probably benign Het
Itpr2 A C 6: 146,385,971 D452E probably benign Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lrit1 T C 14: 37,061,753 V346A possibly damaging Het
Lrrk1 A G 7: 66,262,437 S1792P probably benign Het
Marveld2 A T 13: 100,600,621 V168E probably benign Het
Ms4a4b T A 19: 11,461,265 D149E probably damaging Het
Myom2 G A 8: 15,114,278 D1058N probably benign Het
Ncam2 C T 16: 81,437,683 P142L probably damaging Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nol10 T C 12: 17,368,389 probably null Het
Nrcam T C 12: 44,544,755 V194A probably damaging Het
Nudt6 A G 3: 37,412,400 V82A probably benign Het
Odf2l A T 3: 145,151,048 N492I probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Pkn3 T C 2: 30,082,828 V276A probably damaging Het
Prl3b1 T G 13: 27,247,903 L137R possibly damaging Het
Rab11fip2 A G 19: 59,937,330 F10L probably damaging Het
Rab3b T A 4: 108,929,452 V133E probably damaging Het
Rnf111 A T 9: 70,476,238 S138T probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Runx1t1 A G 4: 13,835,767 T75A probably benign Het
Ryr2 T G 13: 11,738,356 K1693T probably damaging Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Setd2 T G 9: 110,556,418 probably null Het
Sh3tc2 A G 18: 62,008,575 Y1109C probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc22a2 A G 17: 12,614,826 probably benign Het
Slc35f4 A T 14: 49,313,634 W108R probably damaging Het
Slc4a1ap A G 5: 31,534,180 E440G probably damaging Het
Slc6a4 A G 11: 77,013,375 T219A probably benign Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Svil T G 18: 5,094,640 V1440G possibly damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tbck T C 3: 132,724,916 probably null Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Top1mt C T 15: 75,667,901 R287H possibly damaging Het
Troap T A 15: 99,077,898 C233S probably benign Het
Usp28 T C 9: 49,035,947 M571T probably damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vipr1 C T 9: 121,665,864 P327L possibly damaging Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn1r69 G A 7: 10,580,751 R18W probably benign Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps13b A T 15: 35,430,291 probably benign Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp385c A C 11: 100,630,706 V176G probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Other mutations in Trdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Trdn APN 10 33471606 critical splice donor site probably null
IGL01310:Trdn APN 10 33305098 splice site probably benign
IGL01313:Trdn APN 10 33200220 missense probably damaging 1.00
IGL02177:Trdn APN 10 33139173 missense probably damaging 1.00
IGL02631:Trdn APN 10 33363976 critical splice acceptor site probably null
IGL02732:Trdn APN 10 33468199 splice site probably null
IGL03131:Trdn APN 10 33398414 nonsense probably null
Button UTSW 10 33474453 missense probably damaging 0.97
R0463:Trdn UTSW 10 33466421 critical splice acceptor site probably null
R0610:Trdn UTSW 10 33474453 missense probably damaging 0.97
R0786:Trdn UTSW 10 33305081 missense probably benign 0.22
R0827:Trdn UTSW 10 33399158 splice site probably benign
R1511:Trdn UTSW 10 33466452 missense probably benign 0.18
R1623:Trdn UTSW 10 33258102 missense possibly damaging 0.82
R1760:Trdn UTSW 10 33233887 missense possibly damaging 0.92
R1766:Trdn UTSW 10 33364008 missense probably damaging 1.00
R2297:Trdn UTSW 10 33335012 missense probably damaging 1.00
R2396:Trdn UTSW 10 33195982 missense probably damaging 1.00
R3436:Trdn UTSW 10 33468195 critical splice donor site probably null
R3686:Trdn UTSW 10 33468189 missense probably benign 0.20
R3696:Trdn UTSW 10 33305032 splice site probably null
R3701:Trdn UTSW 10 33334984 missense probably damaging 0.99
R3712:Trdn UTSW 10 33157166 missense probably benign 0.03
R4062:Trdn UTSW 10 33257087 missense probably benign 0.05
R4249:Trdn UTSW 10 33450998 missense probably benign 0.09
R4289:Trdn UTSW 10 33464582 missense probably benign 0.00
R4646:Trdn UTSW 10 33195981 nonsense probably null
R4647:Trdn UTSW 10 33195981 nonsense probably null
R4648:Trdn UTSW 10 33195981 nonsense probably null
R4766:Trdn UTSW 10 33474506 missense probably benign 0.04
R4776:Trdn UTSW 10 33399082 splice site probably null
R4880:Trdn UTSW 10 33471579 missense probably benign 0.26
R4898:Trdn UTSW 10 33474417 missense probably damaging 0.96
R5017:Trdn UTSW 10 33468159 missense probably benign 0.05
R5300:Trdn UTSW 10 33195982 missense probably damaging 1.00
R5320:Trdn UTSW 10 33333251 critical splice donor site probably null
R6089:Trdn UTSW 10 33464575 missense probably benign 0.01
R6216:Trdn UTSW 10 33305069 missense probably damaging 1.00
R6431:Trdn UTSW 10 33139114 missense probably damaging 1.00
R6475:Trdn UTSW 10 33464555 splice site probably null
R6501:Trdn UTSW 10 33466454 missense probably benign 0.02
R6662:Trdn UTSW 10 33474487 missense probably damaging 0.98
R6709:Trdn UTSW 10 33464591 missense probably benign 0.00
R6783:Trdn UTSW 10 33438815 missense probably damaging 0.96
R6906:Trdn UTSW 10 33233948 missense probably benign
R6916:Trdn UTSW 10 33157018 missense probably damaging 1.00
R7291:Trdn UTSW 10 33437736 missense probably null 0.83
Predicted Primers PCR Primer
(F):5'- CACAAGGTTGCCTAGGACAG -3'
(R):5'- ATGAGACTCATGATCAGCCTGAG -3'

Sequencing Primer
(F):5'- AGGTTGCCTAGGACAGAACCC -3'
(R):5'- GCCTGAGCTAAACAGACAAATTTC -3'
Posted On2014-06-30