Incidental Mutation 'R1884:Slc6a4'
ID209369
Institutional Source Beutler Lab
Gene Symbol Slc6a4
Ensembl Gene ENSMUSG00000020838
Gene Namesolute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Synonyms5-HTT, Sert, Htt
MMRRC Submission 039905-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R1884 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location76998603-77032340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77013375 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 219 (T219A)
Ref Sequence ENSEMBL: ENSMUSP00000104039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021195] [ENSMUST00000108402] [ENSMUST00000129572]
Predicted Effect probably benign
Transcript: ENSMUST00000021195
AA Change: T219A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000021195
Gene: ENSMUSG00000020838
AA Change: T219A

DomainStartEndE-ValueType
Pfam:5HT_transport_N 24 64 3e-27 PFAM
Pfam:SNF 79 600 7.3e-232 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108402
AA Change: T219A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104039
Gene: ENSMUSG00000020838
AA Change: T219A

DomainStartEndE-ValueType
Pfam:5HT_transporter 23 64 7.8e-30 PFAM
Pfam:SNF 79 600 7.3e-232 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129572
SMART Domains Protein: ENSMUSP00000115264
Gene: ENSMUSG00000020838

DomainStartEndE-ValueType
Pfam:5HT_transporter 23 64 1e-30 PFAM
Pfam:SNF 79 158 1.8e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138817
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that transports the neurotransmitter serotonin from synaptic spaces into presynaptic neurons. The encoded protein terminates the action of serotonin and recycles it in a sodium-dependent manner. This protein is a target of psychomotor stimulants, such as amphetamines and cocaine, and is a member of the sodium:neurotransmitter symporter family. A repeat length polymorphism in the promoter of this gene has been shown to affect the rate of serotonin uptake and may play a role in sudden infant death syndrome, aggressive behavior in Alzheimer disease patients, and depression-susceptibility in people experiencing emotional trauma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit greatly diminished brain serotonin levels and lack cortical barrel patterns. Also, mutants lack the locomotor enhancing response to the drug (+)-3,4-methylenedioxymethamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T C 9: 104,114,485 M573T probably benign Het
Ank3 A G 10: 70,015,592 T1162A possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arpp21 T A 9: 112,143,527 D232V probably damaging Het
Atg2a T C 19: 6,254,384 Y1144H probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Cenpf C T 1: 189,646,849 V2915I probably benign Het
Cep170 G T 1: 176,774,679 T287K probably benign Het
Chst2 G A 9: 95,405,558 T245I probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Coro7 G T 16: 4,628,819 probably benign Het
Cpne8 C A 15: 90,648,628 probably benign Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx31 T A 2: 28,858,990 I266N probably damaging Het
Dnah7a A T 1: 53,541,000 I1592N probably damaging Het
Dok6 A T 18: 89,474,006 L149Q probably damaging Het
Eri2 G A 7: 119,791,123 T94I probably benign Het
Ermp1 A G 19: 29,616,679 V697A probably benign Het
Foxc1 C T 13: 31,807,665 T153M probably damaging Het
Fry A G 5: 150,403,520 I1224V probably benign Het
Fzd5 G A 1: 64,735,654 T316M probably damaging Het
Gcm1 G T 9: 78,059,579 V27L probably benign Het
Gm5773 A T 3: 93,774,041 D340V probably benign Het
Gucy2d T A 7: 98,451,608 H379Q probably benign Het
Hectd1 T A 12: 51,800,955 M392L probably benign Het
Itpr2 A C 6: 146,385,971 D452E probably benign Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lrit1 T C 14: 37,061,753 V346A possibly damaging Het
Lrrk1 A G 7: 66,262,437 S1792P probably benign Het
Marveld2 A T 13: 100,600,621 V168E probably benign Het
Ms4a4b T A 19: 11,461,265 D149E probably damaging Het
Myom2 G A 8: 15,114,278 D1058N probably benign Het
Ncam2 C T 16: 81,437,683 P142L probably damaging Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nol10 T C 12: 17,368,389 probably null Het
Nrcam T C 12: 44,544,755 V194A probably damaging Het
Nudt6 A G 3: 37,412,400 V82A probably benign Het
Odf2l A T 3: 145,151,048 N492I probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Pkn3 T C 2: 30,082,828 V276A probably damaging Het
Prl3b1 T G 13: 27,247,903 L137R possibly damaging Het
Rab11fip2 A G 19: 59,937,330 F10L probably damaging Het
Rab3b T A 4: 108,929,452 V133E probably damaging Het
Rnf111 A T 9: 70,476,238 S138T probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Runx1t1 A G 4: 13,835,767 T75A probably benign Het
Ryr2 T G 13: 11,738,356 K1693T probably damaging Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Setd2 T G 9: 110,556,418 probably null Het
Sh3tc2 A G 18: 62,008,575 Y1109C probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc22a2 A G 17: 12,614,826 probably benign Het
Slc35f4 A T 14: 49,313,634 W108R probably damaging Het
Slc4a1ap A G 5: 31,534,180 E440G probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Svil T G 18: 5,094,640 V1440G possibly damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tbck T C 3: 132,724,916 probably null Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Top1mt C T 15: 75,667,901 R287H possibly damaging Het
Trdn A G 10: 33,257,095 K314E probably benign Het
Troap T A 15: 99,077,898 C233S probably benign Het
Usp28 T C 9: 49,035,947 M571T probably damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vipr1 C T 9: 121,665,864 P327L possibly damaging Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn1r69 G A 7: 10,580,751 R18W probably benign Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps13b A T 15: 35,430,291 probably benign Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp385c A C 11: 100,630,706 V176G probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Other mutations in Slc6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Slc6a4 APN 11 77023180 missense probably benign 0.00
IGL01403:Slc6a4 APN 11 77031672 missense probably benign 0.00
IGL01608:Slc6a4 APN 11 77027135 missense probably damaging 1.00
IGL01759:Slc6a4 APN 11 77013288 missense probably damaging 1.00
IGL02239:Slc6a4 APN 11 77027156 missense probably benign 0.01
IGL02491:Slc6a4 APN 11 77027208 missense probably damaging 1.00
IGL03221:Slc6a4 APN 11 77027105 missense probably benign
R1122:Slc6a4 UTSW 11 77027186 missense possibly damaging 0.90
R1574:Slc6a4 UTSW 11 77019196 missense possibly damaging 0.93
R1574:Slc6a4 UTSW 11 77019196 missense possibly damaging 0.93
R1768:Slc6a4 UTSW 11 77013252 missense probably damaging 1.00
R1876:Slc6a4 UTSW 11 77015164 missense probably benign 0.34
R4362:Slc6a4 UTSW 11 77017078 missense probably damaging 1.00
R4595:Slc6a4 UTSW 11 77019863 missense probably benign 0.16
R4855:Slc6a4 UTSW 11 77013309 missense probably damaging 1.00
R5569:Slc6a4 UTSW 11 77023255 missense possibly damaging 0.88
R5747:Slc6a4 UTSW 11 77010511 missense probably damaging 0.97
R5802:Slc6a4 UTSW 11 77019236 missense probably damaging 1.00
R6242:Slc6a4 UTSW 11 77018358 nonsense probably null
R6344:Slc6a4 UTSW 11 77018254 missense probably damaging 1.00
R6443:Slc6a4 UTSW 11 77023201 missense probably benign 0.05
R6935:Slc6a4 UTSW 11 77027168 missense probably benign 0.06
R7283:Slc6a4 UTSW 11 77010696 missense probably benign
R7313:Slc6a4 UTSW 11 77010701 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTGTGCAGGCATTGGCTATG -3'
(R):5'- GTGGATCCTGGTGCATATAATTC -3'

Sequencing Primer
(F):5'- TCGCCTCCTACTATAACACC -3'
(R):5'- CAAGATCTGACATCGTCTACTGGAG -3'
Posted On2014-06-30