Incidental Mutation 'R1884:Nol10'
ID209373
Institutional Source Beutler Lab
Gene Symbol Nol10
Ensembl Gene ENSMUSG00000061458
Gene Namenucleolar protein 10
SynonymsLOC217431
MMRRC Submission 039905-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R1884 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location17348458-17430095 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 17368389 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046011]
Predicted Effect probably null
Transcript: ENSMUST00000046011
SMART Domains Protein: ENSMUSP00000035930
Gene: ENSMUSG00000061458

DomainStartEndE-ValueType
WD40 42 81 1.1e1 SMART
Blast:WD40 84 123 1e-8 BLAST
WD40 165 204 3.3e1 SMART
WD40 223 257 4.42e1 SMART
WD40 260 299 1.19e1 SMART
WD40 302 340 1.97e2 SMART
low complexity region 451 476 N/A INTRINSIC
Pfam:NUC153 482 509 1.4e-15 PFAM
low complexity region 515 536 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
coiled coil region 557 588 N/A INTRINSIC
low complexity region 650 660 N/A INTRINSIC
Meta Mutation Damage Score 0.568 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 99% (94/95)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T C 9: 104,114,485 M573T probably benign Het
Ank3 A G 10: 70,015,592 T1162A possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arpp21 T A 9: 112,143,527 D232V probably damaging Het
Atg2a T C 19: 6,254,384 Y1144H probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Cenpf C T 1: 189,646,849 V2915I probably benign Het
Cep170 G T 1: 176,774,679 T287K probably benign Het
Chst2 G A 9: 95,405,558 T245I probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Coro7 G T 16: 4,628,819 probably benign Het
Cpne8 C A 15: 90,648,628 probably benign Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx31 T A 2: 28,858,990 I266N probably damaging Het
Dnah7a A T 1: 53,541,000 I1592N probably damaging Het
Dok6 A T 18: 89,474,006 L149Q probably damaging Het
Eri2 G A 7: 119,791,123 T94I probably benign Het
Ermp1 A G 19: 29,616,679 V697A probably benign Het
Foxc1 C T 13: 31,807,665 T153M probably damaging Het
Fry A G 5: 150,403,520 I1224V probably benign Het
Fzd5 G A 1: 64,735,654 T316M probably damaging Het
Gcm1 G T 9: 78,059,579 V27L probably benign Het
Gm5773 A T 3: 93,774,041 D340V probably benign Het
Gucy2d T A 7: 98,451,608 H379Q probably benign Het
Hectd1 T A 12: 51,800,955 M392L probably benign Het
Itpr2 A C 6: 146,385,971 D452E probably benign Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lrit1 T C 14: 37,061,753 V346A possibly damaging Het
Lrrk1 A G 7: 66,262,437 S1792P probably benign Het
Marveld2 A T 13: 100,600,621 V168E probably benign Het
Ms4a4b T A 19: 11,461,265 D149E probably damaging Het
Myom2 G A 8: 15,114,278 D1058N probably benign Het
Ncam2 C T 16: 81,437,683 P142L probably damaging Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nrcam T C 12: 44,544,755 V194A probably damaging Het
Nudt6 A G 3: 37,412,400 V82A probably benign Het
Odf2l A T 3: 145,151,048 N492I probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Pkn3 T C 2: 30,082,828 V276A probably damaging Het
Prl3b1 T G 13: 27,247,903 L137R possibly damaging Het
Rab11fip2 A G 19: 59,937,330 F10L probably damaging Het
Rab3b T A 4: 108,929,452 V133E probably damaging Het
Rnf111 A T 9: 70,476,238 S138T probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Runx1t1 A G 4: 13,835,767 T75A probably benign Het
Ryr2 T G 13: 11,738,356 K1693T probably damaging Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Setd2 T G 9: 110,556,418 probably null Het
Sh3tc2 A G 18: 62,008,575 Y1109C probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc22a2 A G 17: 12,614,826 probably benign Het
Slc35f4 A T 14: 49,313,634 W108R probably damaging Het
Slc4a1ap A G 5: 31,534,180 E440G probably damaging Het
Slc6a4 A G 11: 77,013,375 T219A probably benign Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Svil T G 18: 5,094,640 V1440G possibly damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tbck T C 3: 132,724,916 probably null Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Top1mt C T 15: 75,667,901 R287H possibly damaging Het
Trdn A G 10: 33,257,095 K314E probably benign Het
Troap T A 15: 99,077,898 C233S probably benign Het
Usp28 T C 9: 49,035,947 M571T probably damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vipr1 C T 9: 121,665,864 P327L possibly damaging Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn1r69 G A 7: 10,580,751 R18W probably benign Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps13b A T 15: 35,430,291 probably benign Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp385c A C 11: 100,630,706 V176G probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Other mutations in Nol10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Nol10 APN 12 17361129 splice site probably benign
R1769:Nol10 UTSW 12 17416708 splice site probably benign
R1930:Nol10 UTSW 12 17348554 start codon destroyed probably null 0.99
R1931:Nol10 UTSW 12 17348554 start codon destroyed probably null 0.99
R2010:Nol10 UTSW 12 17416101 missense probably benign 0.00
R2037:Nol10 UTSW 12 17361151 missense probably benign 0.01
R2168:Nol10 UTSW 12 17373584 missense probably damaging 1.00
R3729:Nol10 UTSW 12 17424673 missense probably benign 0.42
R3731:Nol10 UTSW 12 17424673 missense probably benign 0.42
R4368:Nol10 UTSW 12 17379292 missense probably damaging 1.00
R4618:Nol10 UTSW 12 17348561 missense probably damaging 0.98
R4736:Nol10 UTSW 12 17355287 missense probably damaging 1.00
R5342:Nol10 UTSW 12 17369620 splice site probably null
R5451:Nol10 UTSW 12 17359102 nonsense probably null
R5536:Nol10 UTSW 12 17416137 nonsense probably null
R5586:Nol10 UTSW 12 17416828 missense possibly damaging 0.73
R6045:Nol10 UTSW 12 17348478 start gained probably benign
R6833:Nol10 UTSW 12 17352727 missense probably benign 0.03
R7039:Nol10 UTSW 12 17429184 missense possibly damaging 0.94
R7189:Nol10 UTSW 12 17373561 critical splice acceptor site probably null
R7251:Nol10 UTSW 12 17402107 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGAGAAGTTTCTGAAAACAG -3'
(R):5'- ACTGTTCCAAACCCCTATCAGG -3'

Sequencing Primer
(F):5'- GGAGAAGTTTCTGAAAACAGTGTTC -3'
(R):5'- TCAGGAATGTCTGAAGACTACCTCG -3'
Posted On2014-06-30