Mutagenetix > Incidental Mutation

Incidental Mutation 'R1884:Ryr2'

209379

Institutional Source

Beutler Lab

Gene Symbol

Ryr2

Ensembl Gene

ENSMUSG00000021313

Gene Name

ryanodine receptor 2, cardiac

Synonyms

9330127I20Rik

MMRRC Submission

039905-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1884 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11567988-12121831 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 11753242 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Threonine at position 1693 (K1693T)

Ref Sequence

ENSEMBL: ENSMUSP00000021750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]

AlphaFold

no structure available at present

PDB Structure

X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<

Predicted Effect

probably damaging
Transcript: ENSMUST00000021750
AA Change: K1693T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: K1693T

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	454	648	3.1e-65	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	862	952	1.8e-36	PFAM
Pfam:RyR	976	1066	1.1e-32	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2122	2331	1.2e-71	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2700	2790	1.1e-33	PFAM
Pfam:RyR	2820	2904	7.1e-27	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3829	3947	3.1e-36	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.7e-96	PFAM
Pfam:Ion_trans	4710	4877	8e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170156
AA Change: K1693T

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: K1693T

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	451	655	3.5e-73	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	861	955	1.4e-33	PFAM
Pfam:RyR	975	1069	9.2e-34	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2120	2331	3.9e-65	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2699	2793	1.1e-37	PFAM
Pfam:RyR	2819	2907	9.4e-34	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3825	3958	2.3e-42	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.1e-93	PFAM
Pfam:Ion_trans	4705	4865	9.3e-11	PFAM

Meta Mutation Damage Score

0.0827

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 95.1%
20x: 92.3%

Validation Efficiency

99% (94/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]

Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad11	T	C	9: 103,991,684 (GRCm39)	M573T	probably benign	Het
Ank3	A	G	10: 69,851,422 (GRCm39)	T1162A	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,397,036 (GRCm39)		probably null	Het
Arpp21	T	A	9: 111,972,595 (GRCm39)	D232V	probably damaging	Het
Atg2a	T	C	19: 6,304,414 (GRCm39)	Y1144H	probably damaging	Het
Auh	G	A	13: 52,989,532 (GRCm39)	P308L	probably benign	Het
Brs3	T	C	X: 56,092,449 (GRCm39)	I311T	probably benign	Het
Cenpf	C	T	1: 189,379,046 (GRCm39)	V2915I	probably benign	Het
Cep170	G	T	1: 176,602,245 (GRCm39)	T287K	probably benign	Het
Chst2	G	A	9: 95,287,611 (GRCm39)	T245I	probably damaging	Het
Cnot4	C	T	6: 35,055,092 (GRCm39)	V66I	probably damaging	Het
Cntn4	A	G	6: 106,656,353 (GRCm39)	T885A	probably benign	Het
Col20a1	C	T	2: 180,634,703 (GRCm39)	T131I	possibly damaging	Het
Coro7	G	T	16: 4,446,683 (GRCm39)		probably benign	Het
Cpne8	C	A	15: 90,532,831 (GRCm39)		probably benign	Het
Dbnl	G	A	11: 5,749,247 (GRCm39)	G356E	probably benign	Het
Ddx31	T	A	2: 28,749,002 (GRCm39)	I266N	probably damaging	Het
Dnah7a	A	T	1: 53,580,159 (GRCm39)	I1592N	probably damaging	Het
Dok6	A	T	18: 89,492,130 (GRCm39)	L149Q	probably damaging	Het
Eri2	G	A	7: 119,390,346 (GRCm39)	T94I	probably benign	Het
Ermp1	A	G	19: 29,594,079 (GRCm39)	V697A	probably benign	Het
Foxc1	C	T	13: 31,991,648 (GRCm39)	T153M	probably damaging	Het
Fry	A	G	5: 150,326,985 (GRCm39)	I1224V	probably benign	Het
Fzd5	G	A	1: 64,774,813 (GRCm39)	T316M	probably damaging	Het
Gcm1	G	T	9: 77,966,861 (GRCm39)	V27L	probably benign	Het
Gm5773	A	T	3: 93,681,348 (GRCm39)	D340V	probably benign	Het
Gucy2d	T	A	7: 98,100,815 (GRCm39)	H379Q	probably benign	Het
Hectd1	T	A	12: 51,847,738 (GRCm39)	M392L	probably benign	Het
Itpr2	A	C	6: 146,287,469 (GRCm39)	D452E	probably benign	Het
Krtap2-4	G	C	11: 99,505,505 (GRCm39)		probably benign	Het
Lrit1	T	C	14: 36,783,710 (GRCm39)	V346A	possibly damaging	Het
Lrrk1	A	G	7: 65,912,185 (GRCm39)	S1792P	probably benign	Het
Marveld2	A	T	13: 100,737,129 (GRCm39)	V168E	probably benign	Het
Ms4a4b	T	A	19: 11,438,629 (GRCm39)	D149E	probably damaging	Het
Myom2	G	A	8: 15,164,278 (GRCm39)	D1058N	probably benign	Het
Ncam2	C	T	16: 81,234,571 (GRCm39)	P142L	probably damaging	Het
Nek9	A	G	12: 85,379,330 (GRCm39)	L192P	probably damaging	Het
Nol10	T	C	12: 17,418,390 (GRCm39)		probably null	Het
Nrcam	T	C	12: 44,591,538 (GRCm39)	V194A	probably damaging	Het
Nudt6	A	G	3: 37,466,549 (GRCm39)	V82A	probably benign	Het
Odf2l	A	T	3: 144,856,809 (GRCm39)	N492I	probably damaging	Het
Or2a12	T	C	6: 42,904,764 (GRCm39)	S200P	probably damaging	Het
Or51f1d	T	C	7: 102,701,189 (GRCm39)	I228T	probably benign	Het
Pkn3	T	C	2: 29,972,840 (GRCm39)	V276A	probably damaging	Het
Prl3b1	T	G	13: 27,431,886 (GRCm39)	L137R	possibly damaging	Het
Rab11fip2	A	G	19: 59,925,762 (GRCm39)	F10L	probably damaging	Het
Rab3b	T	A	4: 108,786,649 (GRCm39)	V133E	probably damaging	Het
Rnf111	A	T	9: 70,383,520 (GRCm39)	S138T	probably damaging	Het
Rsf1	G	A	7: 97,229,117 (GRCm39)		probably benign	Het
Runx1t1	A	G	4: 13,835,767 (GRCm39)	T75A	probably benign	Het
Sdha	A	T	13: 74,481,255 (GRCm39)	I317N	probably damaging	Het
Serpina1d	T	A	12: 103,732,037 (GRCm39)	D274V	possibly damaging	Het
Setd2	T	G	9: 110,385,486 (GRCm39)		probably null	Het
Sh3tc2	A	G	18: 62,141,646 (GRCm39)	Y1109C	probably damaging	Het
Sik3	C	G	9: 46,132,387 (GRCm39)	H1276Q	probably benign	Het
Slc22a2	A	G	17: 12,833,713 (GRCm39)		probably benign	Het
Slc35f4	A	T	14: 49,551,091 (GRCm39)	W108R	probably damaging	Het
Slc4a1ap	A	G	5: 31,691,524 (GRCm39)	E440G	probably damaging	Het
Slc6a4	A	G	11: 76,904,201 (GRCm39)	T219A	probably benign	Het
Stxbp5	C	A	10: 9,688,042 (GRCm39)	V420F	possibly damaging	Het
Svil	T	G	18: 5,094,640 (GRCm39)	V1440G	possibly damaging	Het
Tas2r126	A	T	6: 42,411,961 (GRCm39)	T165S	probably benign	Het
Tbck	T	C	3: 132,430,677 (GRCm39)		probably null	Het
Tnxb	T	A	17: 34,908,539 (GRCm39)	D1520E	probably benign	Het
Top1mt	C	T	15: 75,539,750 (GRCm39)	R287H	possibly damaging	Het
Trdn	A	G	10: 33,133,091 (GRCm39)	K314E	probably benign	Het
Troap	T	A	15: 98,975,779 (GRCm39)	C233S	probably benign	Het
Usp28	T	C	9: 48,947,247 (GRCm39)	M571T	probably damaging	Het
Vac14	A	G	8: 111,438,319 (GRCm39)	H644R	probably damaging	Het
Vipr1	C	T	9: 121,494,930 (GRCm39)	P327L	possibly damaging	Het
Vmn1r31	C	T	6: 58,449,029 (GRCm39)	V279I	probably damaging	Het
Vmn1r69	G	A	7: 10,314,678 (GRCm39)	R18W	probably benign	Het
Vmn2r18	G	T	5: 151,499,190 (GRCm39)	Q425K	probably benign	Het
Vmn2r60	T	C	7: 41,786,094 (GRCm39)	V299A	probably damaging	Het
Vps13b	A	T	15: 35,430,437 (GRCm39)		probably benign	Het
Zfp157	A	G	5: 138,443,102 (GRCm39)	D31G	probably damaging	Het
Zfp385c	A	C	11: 100,521,532 (GRCm39)	V176G	probably benign	Het
Zfp831	A	G	2: 174,545,870 (GRCm39)	H1325R	possibly damaging	Het

Other mutations in Ryr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Ryr2	APN	13	11,848,978 (GRCm39)	splice site	probably benign
IGL00757:Ryr2	APN	13	11,633,490 (GRCm39)	splice site	probably null
IGL00838:Ryr2	APN	13	11,583,389 (GRCm39)	missense	probably damaging	0.98
IGL00849:Ryr2	APN	13	11,600,364 (GRCm39)	missense	possibly damaging	0.91
IGL00987:Ryr2	APN	13	11,750,388 (GRCm39)	missense	probably damaging	0.99
IGL01096:Ryr2	APN	13	11,718,430 (GRCm39)	missense	probably damaging	1.00
IGL01313:Ryr2	APN	13	11,653,371 (GRCm39)	critical splice acceptor site	probably null
IGL01349:Ryr2	APN	13	11,602,125 (GRCm39)	missense	possibly damaging	0.93
IGL01391:Ryr2	APN	13	11,571,571 (GRCm39)	missense	possibly damaging	0.96
IGL01401:Ryr2	APN	13	11,606,238 (GRCm39)	missense	possibly damaging	0.80
IGL01412:Ryr2	APN	13	11,756,922 (GRCm39)	missense	probably benign	0.10
IGL01419:Ryr2	APN	13	11,814,723 (GRCm39)	missense	possibly damaging	0.51
IGL01432:Ryr2	APN	13	11,866,090 (GRCm39)	missense	possibly damaging	0.63
IGL01533:Ryr2	APN	13	11,736,676 (GRCm39)	missense	probably damaging	1.00
IGL01571:Ryr2	APN	13	11,736,647 (GRCm39)	missense	probably damaging	1.00
IGL01584:Ryr2	APN	13	11,616,644 (GRCm39)	critical splice donor site	probably null
IGL01611:Ryr2	APN	13	11,606,202 (GRCm39)	missense	possibly damaging	0.67
IGL01632:Ryr2	APN	13	11,609,854 (GRCm39)	missense	probably damaging	0.97
IGL01643:Ryr2	APN	13	11,707,563 (GRCm39)	missense	possibly damaging	0.94
IGL01647:Ryr2	APN	13	11,600,366 (GRCm39)	missense	probably damaging	1.00
IGL01730:Ryr2	APN	13	11,616,728 (GRCm39)	missense	possibly damaging	0.86
IGL01834:Ryr2	APN	13	11,610,311 (GRCm39)	missense	possibly damaging	0.71
IGL01921:Ryr2	APN	13	11,569,436 (GRCm39)	missense	possibly damaging	0.96
IGL01937:Ryr2	APN	13	11,805,249 (GRCm39)	missense	probably damaging	1.00
IGL01945:Ryr2	APN	13	11,805,249 (GRCm39)	missense	probably damaging	1.00
IGL02027:Ryr2	APN	13	11,611,998 (GRCm39)	missense	probably damaging	1.00
IGL02060:Ryr2	APN	13	11,762,450 (GRCm39)	missense	probably damaging	1.00
IGL02065:Ryr2	APN	13	11,587,143 (GRCm39)	missense	possibly damaging	0.92
IGL02084:Ryr2	APN	13	11,807,648 (GRCm39)	nonsense	probably null
IGL02086:Ryr2	APN	13	11,750,442 (GRCm39)	missense	probably damaging	1.00
IGL02095:Ryr2	APN	13	11,774,645 (GRCm39)	missense	probably damaging	0.98
IGL02100:Ryr2	APN	13	11,752,759 (GRCm39)	missense	possibly damaging	0.92
IGL02122:Ryr2	APN	13	11,756,755 (GRCm39)	missense	probably damaging	1.00
IGL02202:Ryr2	APN	13	11,745,274 (GRCm39)	missense	probably damaging	0.97
IGL02202:Ryr2	APN	13	11,762,544 (GRCm39)	splice site	probably benign
IGL02369:Ryr2	APN	13	11,634,382 (GRCm39)	missense	possibly damaging	0.68
IGL02383:Ryr2	APN	13	11,737,607 (GRCm39)	splice site	probably benign
IGL02400:Ryr2	APN	13	11,620,130 (GRCm39)	splice site	probably benign
IGL02423:Ryr2	APN	13	11,760,084 (GRCm39)	missense	probably damaging	1.00
IGL02425:Ryr2	APN	13	11,760,560 (GRCm39)	missense	probably damaging	0.99
IGL02458:Ryr2	APN	13	11,720,585 (GRCm39)	missense	probably benign	0.15
IGL02602:Ryr2	APN	13	11,569,397 (GRCm39)	utr 3 prime	probably benign
IGL02694:Ryr2	APN	13	11,620,075 (GRCm39)	missense	probably damaging	1.00
IGL02726:Ryr2	APN	13	11,753,206 (GRCm39)	missense	probably damaging	1.00
IGL02747:Ryr2	APN	13	11,670,563 (GRCm39)	missense	probably damaging	1.00
IGL02795:Ryr2	APN	13	11,610,076 (GRCm39)	missense	probably benign	0.21
IGL02876:Ryr2	APN	13	11,722,679 (GRCm39)	missense	probably benign	0.39
IGL02878:Ryr2	APN	13	11,933,205 (GRCm39)	missense	probably benign	0.10
IGL02887:Ryr2	APN	13	11,606,155 (GRCm39)	missense	probably damaging	0.97
IGL02926:Ryr2	APN	13	11,774,721 (GRCm39)	missense	probably damaging	0.99
IGL03030:Ryr2	APN	13	11,699,365 (GRCm39)	missense	probably damaging	0.99
IGL03064:Ryr2	APN	13	11,658,788 (GRCm39)	critical splice acceptor site	probably null
IGL03102:Ryr2	APN	13	11,650,468 (GRCm39)	splice site	probably benign
IGL03152:Ryr2	APN	13	11,868,036 (GRCm39)	missense	probably damaging	1.00
IGL03176:Ryr2	APN	13	11,756,909 (GRCm39)	nonsense	probably null
IGL03180:Ryr2	APN	13	11,583,449 (GRCm39)	missense	possibly damaging	0.95
IGL03213:Ryr2	APN	13	11,739,273 (GRCm39)	splice site	probably benign
IGL03390:Ryr2	APN	13	11,787,302 (GRCm39)	missense	probably benign
IGL03410:Ryr2	APN	13	11,603,033 (GRCm39)	missense	probably damaging	0.99
Arruda	UTSW	13	11,658,781 (GRCm39)	missense	probably damaging	1.00
Arruda2	UTSW	13	11,894,382 (GRCm39)	missense	probably damaging	1.00
Arruda3	UTSW	13	11,570,334 (GRCm39)	missense	possibly damaging	0.91
barricuda	UTSW	13	11,609,900 (GRCm39)	missense	probably benign	0.06
BB006:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
BB006:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
BB016:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
BB016:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
H8562:Ryr2	UTSW	13	11,732,027 (GRCm39)	splice site	probably benign
IGL02799:Ryr2	UTSW	13	11,680,848 (GRCm39)	missense	probably damaging	1.00
IGL02991:Ryr2	UTSW	13	11,776,192 (GRCm39)	missense	probably damaging	0.99
PIT4142001:Ryr2	UTSW	13	11,722,682 (GRCm39)	missense	probably damaging	0.97
PIT4260001:Ryr2	UTSW	13	11,609,641 (GRCm39)	missense	possibly damaging	0.93
PIT4458001:Ryr2	UTSW	13	11,570,334 (GRCm39)	missense	probably benign	0.29
R0003:Ryr2	UTSW	13	11,839,265 (GRCm39)	missense	probably damaging	1.00
R0004:Ryr2	UTSW	13	11,680,805 (GRCm39)	missense	probably benign
R0018:Ryr2	UTSW	13	11,610,109 (GRCm39)	missense	possibly damaging	0.94
R0048:Ryr2	UTSW	13	11,610,670 (GRCm39)	missense	probably damaging	1.00
R0048:Ryr2	UTSW	13	11,610,670 (GRCm39)	missense	probably damaging	1.00
R0056:Ryr2	UTSW	13	11,683,924 (GRCm39)	missense	probably damaging	0.97
R0062:Ryr2	UTSW	13	11,884,002 (GRCm39)	critical splice donor site	probably null
R0062:Ryr2	UTSW	13	11,884,002 (GRCm39)	critical splice donor site	probably null
R0080:Ryr2	UTSW	13	11,583,361 (GRCm39)	missense	probably damaging	0.98
R0116:Ryr2	UTSW	13	11,724,807 (GRCm39)	missense	probably damaging	1.00
R0148:Ryr2	UTSW	13	11,729,434 (GRCm39)	missense	probably damaging	1.00
R0206:Ryr2	UTSW	13	11,691,137 (GRCm39)	splice site	probably benign
R0226:Ryr2	UTSW	13	11,787,442 (GRCm39)	missense	probably damaging	1.00
R0285:Ryr2	UTSW	13	11,731,863 (GRCm39)	missense	probably damaging	1.00
R0365:Ryr2	UTSW	13	11,683,725 (GRCm39)	missense	possibly damaging	0.90
R0401:Ryr2	UTSW	13	11,720,570 (GRCm39)	missense	probably benign	0.45
R0415:Ryr2	UTSW	13	11,884,042 (GRCm39)	missense	probably damaging	0.97
R0418:Ryr2	UTSW	13	11,848,981 (GRCm39)	splice site	probably benign
R0558:Ryr2	UTSW	13	11,814,747 (GRCm39)	missense	probably damaging	1.00
R0558:Ryr2	UTSW	13	11,653,329 (GRCm39)	missense	probably damaging	1.00
R0574:Ryr2	UTSW	13	11,746,555 (GRCm39)	missense	probably benign	0.02
R0586:Ryr2	UTSW	13	11,650,445 (GRCm39)	missense	probably null
R0601:Ryr2	UTSW	13	11,720,519 (GRCm39)	critical splice donor site	probably null
R0610:Ryr2	UTSW	13	11,637,838 (GRCm39)	missense	probably damaging	1.00
R0648:Ryr2	UTSW	13	11,739,219 (GRCm39)	missense	possibly damaging	0.86
R0727:Ryr2	UTSW	13	11,581,771 (GRCm39)	missense	probably damaging	1.00
R0743:Ryr2	UTSW	13	11,569,415 (GRCm39)	missense	probably damaging	0.99
R0821:Ryr2	UTSW	13	11,753,012 (GRCm39)	missense	probably benign	0.35
R0884:Ryr2	UTSW	13	11,569,415 (GRCm39)	missense	probably damaging	0.99
R1104:Ryr2	UTSW	13	11,684,855 (GRCm39)	missense	probably damaging	0.99
R1114:Ryr2	UTSW	13	11,960,867 (GRCm39)	missense	probably damaging	0.98
R1167:Ryr2	UTSW	13	11,674,999 (GRCm39)	missense	possibly damaging	0.94
R1238:Ryr2	UTSW	13	11,774,589 (GRCm39)	missense	probably damaging	1.00
R1239:Ryr2	UTSW	13	11,897,929 (GRCm39)	critical splice donor site	probably null
R1296:Ryr2	UTSW	13	11,702,765 (GRCm39)	splice site	probably benign
R1400:Ryr2	UTSW	13	11,609,962 (GRCm39)	missense	probably benign	0.08
R1439:Ryr2	UTSW	13	11,729,389 (GRCm39)	splice site	probably benign
R1443:Ryr2	UTSW	13	11,794,152 (GRCm39)	missense	probably benign	0.19
R1446:Ryr2	UTSW	13	11,753,035 (GRCm39)	missense	probably benign	0.09
R1458:Ryr2	UTSW	13	11,741,908 (GRCm39)	missense	probably damaging	0.97
R1497:Ryr2	UTSW	13	11,616,727 (GRCm39)	missense	probably damaging	0.99
R1505:Ryr2	UTSW	13	11,569,478 (GRCm39)	missense	possibly damaging	0.84
R1548:Ryr2	UTSW	13	11,569,435 (GRCm39)	nonsense	probably null
R1551:Ryr2	UTSW	13	11,800,029 (GRCm39)	critical splice acceptor site	probably null
R1567:Ryr2	UTSW	13	11,774,563 (GRCm39)	missense	possibly damaging	0.87
R1581:Ryr2	UTSW	13	11,809,449 (GRCm39)	missense	probably benign	0.01
R1645:Ryr2	UTSW	13	11,733,368 (GRCm39)	nonsense	probably null
R1686:Ryr2	UTSW	13	11,618,665 (GRCm39)	splice site	probably benign
R1696:Ryr2	UTSW	13	11,746,543 (GRCm39)	missense	probably benign	0.02
R1708:Ryr2	UTSW	13	11,602,328 (GRCm39)	splice site	probably null
R1728:Ryr2	UTSW	13	11,602,308 (GRCm39)	missense	possibly damaging	0.94
R1745:Ryr2	UTSW	13	11,805,153 (GRCm39)	missense	probably damaging	1.00
R1771:Ryr2	UTSW	13	11,760,062 (GRCm39)	critical splice donor site	probably null
R1776:Ryr2	UTSW	13	11,760,062 (GRCm39)	critical splice donor site	probably null
R1783:Ryr2	UTSW	13	11,715,257 (GRCm39)	nonsense	probably null
R1801:Ryr2	UTSW	13	11,610,167 (GRCm39)	missense	probably benign	0.01
R1812:Ryr2	UTSW	13	11,575,472 (GRCm39)	missense	probably damaging	0.97
R1820:Ryr2	UTSW	13	11,602,202 (GRCm39)	missense	probably damaging	0.99
R1835:Ryr2	UTSW	13	11,784,764 (GRCm39)	missense	probably benign	0.06
R1868:Ryr2	UTSW	13	11,746,586 (GRCm39)	missense	probably benign	0.02
R1869:Ryr2	UTSW	13	11,676,961 (GRCm39)	missense	probably damaging	0.98
R1892:Ryr2	UTSW	13	11,673,844 (GRCm39)	nonsense	probably null
R1897:Ryr2	UTSW	13	11,765,818 (GRCm39)	missense	probably benign	0.09
R1899:Ryr2	UTSW	13	11,606,222 (GRCm39)	missense	probably benign
R1909:Ryr2	UTSW	13	11,715,235 (GRCm39)	missense	probably damaging	1.00
R1918:Ryr2	UTSW	13	11,571,584 (GRCm39)	missense	possibly damaging	0.91
R1937:Ryr2	UTSW	13	11,683,848 (GRCm39)	missense	probably damaging	1.00
R1943:Ryr2	UTSW	13	11,746,609 (GRCm39)	missense	probably benign	0.10
R1956:Ryr2	UTSW	13	11,695,966 (GRCm39)	missense	probably damaging	1.00
R1983:Ryr2	UTSW	13	11,600,288 (GRCm39)	splice site	probably null
R2018:Ryr2	UTSW	13	11,866,074 (GRCm39)	missense	possibly damaging	0.59
R2019:Ryr2	UTSW	13	11,866,074 (GRCm39)	missense	possibly damaging	0.59
R2060:Ryr2	UTSW	13	11,610,622 (GRCm39)	missense	probably damaging	1.00
R2061:Ryr2	UTSW	13	11,680,764 (GRCm39)	splice site	probably null
R2088:Ryr2	UTSW	13	11,677,115 (GRCm39)	missense	probably benign	0.04
R2089:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2127:Ryr2	UTSW	13	11,727,081 (GRCm39)	missense	probably damaging	1.00
R2140:Ryr2	UTSW	13	11,575,493 (GRCm39)	missense	probably damaging	1.00
R2153:Ryr2	UTSW	13	11,592,759 (GRCm39)	missense	possibly damaging	0.86
R2179:Ryr2	UTSW	13	11,720,679 (GRCm39)	nonsense	probably null
R2207:Ryr2	UTSW	13	11,825,823 (GRCm39)	missense	probably damaging	1.00
R2237:Ryr2	UTSW	13	11,677,146 (GRCm39)	missense	probably benign	0.18
R2258:Ryr2	UTSW	13	11,753,102 (GRCm39)	missense	possibly damaging	0.94
R2312:Ryr2	UTSW	13	11,753,128 (GRCm39)	missense	probably damaging	1.00
R2421:Ryr2	UTSW	13	11,606,123 (GRCm39)	missense	probably damaging	0.98
R2438:Ryr2	UTSW	13	11,816,734 (GRCm39)	missense	probably damaging	1.00
R2483:Ryr2	UTSW	13	11,774,589 (GRCm39)	missense	probably damaging	1.00
R2860:Ryr2	UTSW	13	11,607,979 (GRCm39)	missense	probably damaging	0.98
R2861:Ryr2	UTSW	13	11,607,979 (GRCm39)	missense	probably damaging	0.98
R2867:Ryr2	UTSW	13	11,776,235 (GRCm39)	missense	probably damaging	1.00
R2867:Ryr2	UTSW	13	11,776,235 (GRCm39)	missense	probably damaging	1.00
R3618:Ryr2	UTSW	13	11,787,466 (GRCm39)	critical splice acceptor site	probably null
R3876:Ryr2	UTSW	13	11,603,045 (GRCm39)	missense	probably damaging	0.99
R3906:Ryr2	UTSW	13	11,753,095 (GRCm39)	missense	possibly damaging	0.87
R3912:Ryr2	UTSW	13	11,787,313 (GRCm39)	missense	probably damaging	0.99
R4018:Ryr2	UTSW	13	11,933,300 (GRCm39)	missense	probably damaging	1.00
R4114:Ryr2	UTSW	13	11,707,568 (GRCm39)	missense	probably damaging	1.00
R4119:Ryr2	UTSW	13	11,794,153 (GRCm39)	missense	probably benign	0.22
R4127:Ryr2	UTSW	13	11,602,323 (GRCm39)	missense	possibly damaging	0.91
R4222:Ryr2	UTSW	13	11,752,759 (GRCm39)	missense	possibly damaging	0.92
R4233:Ryr2	UTSW	13	11,765,611 (GRCm39)	missense	probably benign	0.20
R4355:Ryr2	UTSW	13	11,664,698 (GRCm39)	missense	probably benign	0.05
R4384:Ryr2	UTSW	13	11,620,119 (GRCm39)	missense	probably damaging	0.99
R4422:Ryr2	UTSW	13	11,731,952 (GRCm39)	nonsense	probably null
R4430:Ryr2	UTSW	13	11,750,413 (GRCm39)	missense	probably damaging	0.98
R4624:Ryr2	UTSW	13	12,121,301 (GRCm39)	missense	possibly damaging	0.47
R4663:Ryr2	UTSW	13	11,764,395 (GRCm39)	missense	possibly damaging	0.47
R4665:Ryr2	UTSW	13	11,765,571 (GRCm39)	splice site	probably null
R4668:Ryr2	UTSW	13	11,608,003 (GRCm39)	missense	probably benign
R4677:Ryr2	UTSW	13	11,721,553 (GRCm39)	missense	probably damaging	0.98
R4679:Ryr2	UTSW	13	11,839,255 (GRCm39)	missense	probably benign	0.34
R4680:Ryr2	UTSW	13	11,610,119 (GRCm39)	missense	probably benign	0.04
R4685:Ryr2	UTSW	13	11,707,532 (GRCm39)	missense	probably damaging	1.00
R4709:Ryr2	UTSW	13	11,731,884 (GRCm39)	missense	probably damaging	1.00
R4731:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4732:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4733:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4734:Ryr2	UTSW	13	11,752,639 (GRCm39)	missense	probably damaging	0.99
R4740:Ryr2	UTSW	13	11,671,933 (GRCm39)	missense	possibly damaging	0.95
R4801:Ryr2	UTSW	13	11,702,818 (GRCm39)	missense	probably damaging	1.00
R4801:Ryr2	UTSW	13	11,723,113 (GRCm39)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,702,818 (GRCm39)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,723,113 (GRCm39)	missense	probably damaging	1.00
R4804:Ryr2	UTSW	13	11,731,983 (GRCm39)	missense	probably damaging	1.00
R4811:Ryr2	UTSW	13	11,670,584 (GRCm39)	missense	probably damaging	0.97
R4850:Ryr2	UTSW	13	11,760,638 (GRCm39)	missense	probably damaging	1.00
R4850:Ryr2	UTSW	13	11,683,706 (GRCm39)	missense	probably damaging	0.99
R4880:Ryr2	UTSW	13	11,767,104 (GRCm39)	missense	probably damaging	1.00
R4917:Ryr2	UTSW	13	11,609,872 (GRCm39)	missense	probably damaging	0.96
R4918:Ryr2	UTSW	13	11,609,872 (GRCm39)	missense	probably damaging	0.96
R4922:Ryr2	UTSW	13	11,724,849 (GRCm39)	missense	probably damaging	0.99
R4933:Ryr2	UTSW	13	11,960,831 (GRCm39)	missense	probably damaging	0.96
R4950:Ryr2	UTSW	13	11,756,897 (GRCm39)	missense	probably damaging	1.00
R4957:Ryr2	UTSW	13	11,799,966 (GRCm39)	missense	probably damaging	0.97
R4964:Ryr2	UTSW	13	11,848,878 (GRCm39)	missense	probably benign	0.00
R4964:Ryr2	UTSW	13	11,729,497 (GRCm39)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,729,497 (GRCm39)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,848,878 (GRCm39)	missense	probably benign	0.00
R4997:Ryr2	UTSW	13	11,610,192 (GRCm39)	missense	probably benign	0.09
R4998:Ryr2	UTSW	13	11,658,781 (GRCm39)	missense	probably damaging	1.00
R5033:Ryr2	UTSW	13	11,602,140 (GRCm39)	missense	possibly damaging	0.93
R5061:Ryr2	UTSW	13	11,650,422 (GRCm39)	missense	possibly damaging	0.74
R5062:Ryr2	UTSW	13	11,715,240 (GRCm39)	missense	probably damaging	0.97
R5088:Ryr2	UTSW	13	11,727,129 (GRCm39)	nonsense	probably null
R5135:Ryr2	UTSW	13	11,677,016 (GRCm39)	missense	probably benign	0.05
R5138:Ryr2	UTSW	13	11,675,175 (GRCm39)	missense	probably damaging	1.00
R5168:Ryr2	UTSW	13	11,767,207 (GRCm39)	missense	probably benign
R5187:Ryr2	UTSW	13	11,787,338 (GRCm39)	missense	probably damaging	0.99
R5197:Ryr2	UTSW	13	11,653,316 (GRCm39)	critical splice donor site	probably null
R5262:Ryr2	UTSW	13	11,787,323 (GRCm39)	missense	probably damaging	0.99
R5325:Ryr2	UTSW	13	11,705,249 (GRCm39)	missense	probably damaging	0.97
R5381:Ryr2	UTSW	13	11,571,544 (GRCm39)	missense	probably damaging	1.00
R5437:Ryr2	UTSW	13	11,670,599 (GRCm39)	missense	probably damaging	1.00
R5477:Ryr2	UTSW	13	11,720,542 (GRCm39)	missense	probably damaging	1.00
R5497:Ryr2	UTSW	13	11,720,587 (GRCm39)	missense	probably null	0.15
R5509:Ryr2	UTSW	13	11,760,487 (GRCm39)	missense	probably damaging	0.98
R5518:Ryr2	UTSW	13	11,702,795 (GRCm39)	missense	probably benign	0.01
R5571:Ryr2	UTSW	13	11,570,334 (GRCm39)	missense	possibly damaging	0.91
R5591:Ryr2	UTSW	13	11,609,900 (GRCm39)	missense	probably benign	0.06
R5619:Ryr2	UTSW	13	11,723,088 (GRCm39)	missense	probably damaging	1.00
R5630:Ryr2	UTSW	13	11,616,691 (GRCm39)	missense	probably damaging	1.00
R5644:Ryr2	UTSW	13	11,610,468 (GRCm39)	missense	probably damaging	0.99
R5667:Ryr2	UTSW	13	11,774,722 (GRCm39)	missense	probably damaging	1.00
R5775:Ryr2	UTSW	13	11,784,848 (GRCm39)	missense	probably damaging	1.00
R5836:Ryr2	UTSW	13	11,618,618 (GRCm39)	missense	probably damaging	1.00
R5858:Ryr2	UTSW	13	11,575,460 (GRCm39)	missense	probably damaging	0.99
R5934:Ryr2	UTSW	13	11,599,040 (GRCm39)	missense	probably damaging	0.96
R5939:Ryr2	UTSW	13	11,805,218 (GRCm39)	missense	probably damaging	0.99
R5941:Ryr2	UTSW	13	11,702,788 (GRCm39)	missense	probably damaging	1.00
R5945:Ryr2	UTSW	13	11,675,008 (GRCm39)	missense	probably damaging	1.00
R5946:Ryr2	UTSW	13	11,741,839 (GRCm39)	missense	probably damaging	1.00
R5966:Ryr2	UTSW	13	11,677,124 (GRCm39)	nonsense	probably null
R5974:Ryr2	UTSW	13	11,729,397 (GRCm39)	splice site	probably null
R6104:Ryr2	UTSW	13	11,814,711 (GRCm39)	missense	probably damaging	1.00
R6118:Ryr2	UTSW	13	11,807,575 (GRCm39)	missense	possibly damaging	0.69
R6149:Ryr2	UTSW	13	11,683,903 (GRCm39)	missense	probably benign
R6208:Ryr2	UTSW	13	11,910,106 (GRCm39)	missense	probably benign	0.04
R6217:Ryr2	UTSW	13	11,848,964 (GRCm39)	missense	probably damaging	1.00
R6230:Ryr2	UTSW	13	11,674,993 (GRCm39)	missense	probably damaging	0.99
R6279:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R6294:Ryr2	UTSW	13	11,894,382 (GRCm39)	missense	probably damaging	1.00
R6300:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R6350:Ryr2	UTSW	13	11,776,282 (GRCm39)	missense	probably damaging	0.98
R6484:Ryr2	UTSW	13	11,677,269 (GRCm39)	missense	possibly damaging	0.90
R6489:Ryr2	UTSW	13	11,848,893 (GRCm39)	missense	probably benign	0.29
R6548:Ryr2	UTSW	13	11,683,707 (GRCm39)	missense	probably damaging	1.00
R6591:Ryr2	UTSW	13	11,609,609 (GRCm39)	missense	probably benign	0.01
R6623:Ryr2	UTSW	13	11,724,951 (GRCm39)	missense	probably damaging	1.00
R6649:Ryr2	UTSW	13	11,610,529 (GRCm39)	missense	probably damaging	0.99
R6691:Ryr2	UTSW	13	11,609,609 (GRCm39)	missense	probably benign	0.01
R6770:Ryr2	UTSW	13	11,753,348 (GRCm39)	missense	probably damaging	1.00
R6802:Ryr2	UTSW	13	11,701,852 (GRCm39)	missense	probably damaging	1.00
R6809:Ryr2	UTSW	13	11,741,816 (GRCm39)	missense	probably damaging	1.00
R6893:Ryr2	UTSW	13	11,844,540 (GRCm39)	missense	possibly damaging	0.75
R6911:Ryr2	UTSW	13	11,842,445 (GRCm39)	missense	possibly damaging	0.50
R6915:Ryr2	UTSW	13	11,760,487 (GRCm39)	missense	probably damaging	1.00
R6943:Ryr2	UTSW	13	11,581,834 (GRCm39)	missense	possibly damaging	0.92
R6960:Ryr2	UTSW	13	11,816,129 (GRCm39)	missense	probably benign	0.28
R6997:Ryr2	UTSW	13	11,669,266 (GRCm39)	missense	possibly damaging	0.88
R6998:Ryr2	UTSW	13	11,727,052 (GRCm39)	missense	probably damaging	0.99
R7001:Ryr2	UTSW	13	11,809,491 (GRCm39)	missense	probably damaging	0.98
R7047:Ryr2	UTSW	13	11,839,286 (GRCm39)	missense	possibly damaging	0.64
R7089:Ryr2	UTSW	13	11,664,662 (GRCm39)	missense	probably benign	0.10
R7125:Ryr2	UTSW	13	11,684,873 (GRCm39)	missense	probably damaging	0.99
R7127:Ryr2	UTSW	13	11,670,599 (GRCm39)	missense	probably damaging	1.00
R7131:Ryr2	UTSW	13	11,683,697 (GRCm39)	critical splice donor site	probably null
R7131:Ryr2	UTSW	13	11,655,213 (GRCm39)	missense	possibly damaging	0.63
R7159:Ryr2	UTSW	13	11,825,794 (GRCm39)	missense	probably damaging	0.99
R7174:Ryr2	UTSW	13	11,816,063 (GRCm39)	missense	possibly damaging	0.81
R7180:Ryr2	UTSW	13	11,701,864 (GRCm39)	missense	probably damaging	1.00
R7182:Ryr2	UTSW	13	11,774,643 (GRCm39)	missense	probably benign
R7189:Ryr2	UTSW	13	11,898,009 (GRCm39)	missense	probably damaging	1.00
R7241:Ryr2	UTSW	13	11,680,799 (GRCm39)	missense	possibly damaging	0.71
R7244:Ryr2	UTSW	13	11,612,032 (GRCm39)	missense	probably damaging	1.00
R7326:Ryr2	UTSW	13	11,753,080 (GRCm39)	missense	possibly damaging	0.95
R7331:Ryr2	UTSW	13	11,760,517 (GRCm39)	missense	probably benign
R7365:Ryr2	UTSW	13	11,655,161 (GRCm39)	missense	probably damaging	0.99
R7372:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R7395:Ryr2	UTSW	13	11,799,997 (GRCm39)	missense	probably damaging	0.98
R7404:Ryr2	UTSW	13	11,750,506 (GRCm39)	missense	probably damaging	0.97
R7417:Ryr2	UTSW	13	11,571,634 (GRCm39)	splice site	probably null
R7425:Ryr2	UTSW	13	11,720,530 (GRCm39)	missense	probably benign	0.20
R7444:Ryr2	UTSW	13	11,570,349 (GRCm39)	missense	probably benign	0.25
R7456:Ryr2	UTSW	13	11,767,168 (GRCm39)	missense	probably benign
R7460:Ryr2	UTSW	13	11,720,596 (GRCm39)	missense	probably benign	0.10
R7474:Ryr2	UTSW	13	11,609,762 (GRCm39)	missense	probably benign	0.04
R7543:Ryr2	UTSW	13	11,653,317 (GRCm39)	critical splice donor site	probably null
R7549:Ryr2	UTSW	13	11,752,871 (GRCm39)	missense	probably benign	0.15
R7558:Ryr2	UTSW	13	11,814,711 (GRCm39)	missense	probably damaging	1.00
R7565:Ryr2	UTSW	13	11,575,539 (GRCm39)	missense	possibly damaging	0.84
R7627:Ryr2	UTSW	13	11,776,213 (GRCm39)	missense	possibly damaging	0.65
R7698:Ryr2	UTSW	13	11,776,201 (GRCm39)	missense	possibly damaging	0.94
R7702:Ryr2	UTSW	13	11,705,219 (GRCm39)	missense	probably damaging	0.99
R7719:Ryr2	UTSW	13	11,745,229 (GRCm39)	missense	possibly damaging	0.94
R7772:Ryr2	UTSW	13	11,765,897 (GRCm39)	missense	probably benign
R7797:Ryr2	UTSW	13	11,816,066 (GRCm39)	missense	probably damaging	0.99
R7829:Ryr2	UTSW	13	11,842,493 (GRCm39)	missense	possibly damaging	0.81
R7855:Ryr2	UTSW	13	11,721,509 (GRCm39)	nonsense	probably null
R7872:Ryr2	UTSW	13	11,610,610 (GRCm39)	missense	probably damaging	1.00
R7908:Ryr2	UTSW	13	11,807,634 (GRCm39)	missense	probably benign	0.01
R7929:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
R7929:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
R7952:Ryr2	UTSW	13	11,661,313 (GRCm39)	splice site	probably null
R8008:Ryr2	UTSW	13	11,671,980 (GRCm39)	missense	probably benign	0.30
R8011:Ryr2	UTSW	13	11,603,026 (GRCm39)	critical splice donor site	probably null
R8097:Ryr2	UTSW	13	11,960,881 (GRCm39)	missense	probably damaging	0.98
R8133:Ryr2	UTSW	13	11,618,584 (GRCm39)	missense	probably damaging	1.00
R8253:Ryr2	UTSW	13	11,842,439 (GRCm39)	missense	possibly damaging	0.94
R8278:Ryr2	UTSW	13	11,610,392 (GRCm39)	nonsense	probably null
R8351:Ryr2	UTSW	13	11,814,718 (GRCm39)	missense	probably damaging	0.98
R8401:Ryr2	UTSW	13	11,683,821 (GRCm39)	missense	possibly damaging	0.95
R8403:Ryr2	UTSW	13	11,699,364 (GRCm39)	missense	possibly damaging	0.95
R8431:Ryr2	UTSW	13	11,673,894 (GRCm39)	missense	probably benign	0.00
R8509:Ryr2	UTSW	13	11,592,664 (GRCm39)	critical splice donor site	probably null
R8551:Ryr2	UTSW	13	11,575,479 (GRCm39)	missense	possibly damaging	0.93
R8684:Ryr2	UTSW	13	11,702,875 (GRCm39)	missense	probably damaging	0.99
R8735:Ryr2	UTSW	13	11,701,833 (GRCm39)	missense	probably damaging	0.97
R8766:Ryr2	UTSW	13	11,683,855 (GRCm39)	missense	probably damaging	0.97
R8817:Ryr2	UTSW	13	11,750,509 (GRCm39)	missense	possibly damaging	0.95
R8827:Ryr2	UTSW	13	11,572,934 (GRCm39)	missense	possibly damaging	0.80
R8884:Ryr2	UTSW	13	11,794,152 (GRCm39)	missense	probably benign	0.19
R8889:Ryr2	UTSW	13	11,799,990 (GRCm39)	missense	probably damaging	0.99
R8891:Ryr2	UTSW	13	11,814,768 (GRCm39)	missense	probably damaging	1.00
R8979:Ryr2	UTSW	13	11,609,924 (GRCm39)	missense	probably benign	0.00
R9013:Ryr2	UTSW	13	11,618,618 (GRCm39)	missense	probably damaging	0.98
R9040:Ryr2	UTSW	13	11,609,672 (GRCm39)	missense	probably damaging	0.97
R9044:Ryr2	UTSW	13	11,752,989 (GRCm39)	nonsense	probably null
R9056:Ryr2	UTSW	13	11,610,817 (GRCm39)	missense	possibly damaging	0.94
R9084:Ryr2	UTSW	13	11,616,724 (GRCm39)	missense	probably damaging	1.00
R9113:Ryr2	UTSW	13	11,618,741 (GRCm39)	intron	probably benign
R9116:Ryr2	UTSW	13	11,587,185 (GRCm39)	missense	possibly damaging	0.93
R9125:Ryr2	UTSW	13	11,669,292 (GRCm39)	missense	probably benign	0.28
R9148:Ryr2	UTSW	13	11,900,424 (GRCm39)	missense	probably benign	0.02
R9210:Ryr2	UTSW	13	11,844,560 (GRCm39)	missense	probably damaging	0.99
R9212:Ryr2	UTSW	13	11,844,560 (GRCm39)	missense	probably damaging	0.99
R9233:Ryr2	UTSW	13	11,610,772 (GRCm39)	missense	possibly damaging	0.77
R9254:Ryr2	UTSW	13	11,898,002 (GRCm39)	missense	probably damaging	1.00
R9262:Ryr2	UTSW	13	11,765,854 (GRCm39)	missense	probably damaging	0.97
R9275:Ryr2	UTSW	13	11,897,976 (GRCm39)	missense	probably benign	0.10
R9278:Ryr2	UTSW	13	11,897,976 (GRCm39)	missense	probably benign	0.10
R9309:Ryr2	UTSW	13	11,721,578 (GRCm39)	missense	probably damaging	0.99
R9379:Ryr2	UTSW	13	11,898,002 (GRCm39)	missense	probably damaging	1.00
R9409:Ryr2	UTSW	13	11,695,973 (GRCm39)	missense	probably damaging	0.99
R9429:Ryr2	UTSW	13	11,809,459 (GRCm39)	missense	probably damaging	0.97
R9445:Ryr2	UTSW	13	11,787,463 (GRCm39)	missense	probably damaging	1.00
R9464:Ryr2	UTSW	13	11,752,680 (GRCm39)	missense	probably benign	0.00
R9467:Ryr2	UTSW	13	11,571,490 (GRCm39)	missense	possibly damaging	0.70
R9546:Ryr2	UTSW	13	11,602,101 (GRCm39)	critical splice donor site	probably null
R9562:Ryr2	UTSW	13	11,760,104 (GRCm39)	missense	probably damaging	1.00
R9609:Ryr2	UTSW	13	11,683,848 (GRCm39)	missense	probably damaging	1.00
R9704:Ryr2	UTSW	13	11,737,646 (GRCm39)	missense	probably damaging	1.00
R9764:Ryr2	UTSW	13	11,701,935 (GRCm39)	missense	possibly damaging	0.67
R9772:Ryr2	UTSW	13	11,609,785 (GRCm39)	missense	probably benign	0.13
R9776:Ryr2	UTSW	13	11,707,599 (GRCm39)	missense	probably damaging	0.98
S24628:Ryr2	UTSW	13	11,884,042 (GRCm39)	missense	probably damaging	0.97
X0019:Ryr2	UTSW	13	11,718,387 (GRCm39)	missense	probably benign	0.04
Z1176:Ryr2	UTSW	13	11,658,689 (GRCm39)	critical splice donor site	probably null
Z1176:Ryr2	UTSW	13	11,613,497 (GRCm39)	critical splice acceptor site	probably null
Z1176:Ryr2	UTSW	13	11,809,435 (GRCm39)	nonsense	probably null
Z1177:Ryr2	UTSW	13	11,765,759 (GRCm39)	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GCTAATGCTCACGAAACTCGG -3'
(R):5'- AAAGACGTCAGTGCCTGCTC -3'

Sequencing Primer
(F):5'- GAGGTGCTAAGGCCTATGC -3'
(R):5'- ACGTCAGTGCCTGCTCTCTTAAC -3'

Posted On

2014-06-30