Incidental Mutation 'R1884:Top1mt'
ID209389
Institutional Source Beutler Lab
Gene Symbol Top1mt
Ensembl Gene ENSMUSG00000000934
Gene NameDNA topoisomerase 1, mitochondrial
Synonyms
MMRRC Submission 039905-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R1884 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location75657035-75678800 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75667901 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 287 (R287H)
Ref Sequence ENSEMBL: ENSMUSP00000000958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000958]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000958
AA Change: R287H

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000958
Gene: ENSMUSG00000000934
AA Change: R287H

DomainStartEndE-ValueType
Blast:TOPEUc 72 150 4e-38 BLAST
low complexity region 151 166 N/A INTRINSIC
TOPEUc 189 565 5.86e-230 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230774
Meta Mutation Damage Score 0.392 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial DNA topoisomerase that plays a role in the modification of DNA topology. The encoded protein is a type IB topoisomerase and catalyzes the transient breaking and rejoining of DNA to relieve tension and DNA supercoiling generated in the mitochondrial genome during replication and transcription. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a null allele display increased oxidative stress and lipid peroxidation, enhanced glycolysis, and mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T C 9: 104,114,485 M573T probably benign Het
Ank3 A G 10: 70,015,592 T1162A possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arpp21 T A 9: 112,143,527 D232V probably damaging Het
Atg2a T C 19: 6,254,384 Y1144H probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Cenpf C T 1: 189,646,849 V2915I probably benign Het
Cep170 G T 1: 176,774,679 T287K probably benign Het
Chst2 G A 9: 95,405,558 T245I probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Coro7 G T 16: 4,628,819 probably benign Het
Cpne8 C A 15: 90,648,628 probably benign Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx31 T A 2: 28,858,990 I266N probably damaging Het
Dnah7a A T 1: 53,541,000 I1592N probably damaging Het
Dok6 A T 18: 89,474,006 L149Q probably damaging Het
Eri2 G A 7: 119,791,123 T94I probably benign Het
Ermp1 A G 19: 29,616,679 V697A probably benign Het
Foxc1 C T 13: 31,807,665 T153M probably damaging Het
Fry A G 5: 150,403,520 I1224V probably benign Het
Fzd5 G A 1: 64,735,654 T316M probably damaging Het
Gcm1 G T 9: 78,059,579 V27L probably benign Het
Gm5773 A T 3: 93,774,041 D340V probably benign Het
Gucy2d T A 7: 98,451,608 H379Q probably benign Het
Hectd1 T A 12: 51,800,955 M392L probably benign Het
Itpr2 A C 6: 146,385,971 D452E probably benign Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lrit1 T C 14: 37,061,753 V346A possibly damaging Het
Lrrk1 A G 7: 66,262,437 S1792P probably benign Het
Marveld2 A T 13: 100,600,621 V168E probably benign Het
Ms4a4b T A 19: 11,461,265 D149E probably damaging Het
Myom2 G A 8: 15,114,278 D1058N probably benign Het
Ncam2 C T 16: 81,437,683 P142L probably damaging Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nol10 T C 12: 17,368,389 probably null Het
Nrcam T C 12: 44,544,755 V194A probably damaging Het
Nudt6 A G 3: 37,412,400 V82A probably benign Het
Odf2l A T 3: 145,151,048 N492I probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Pkn3 T C 2: 30,082,828 V276A probably damaging Het
Prl3b1 T G 13: 27,247,903 L137R possibly damaging Het
Rab11fip2 A G 19: 59,937,330 F10L probably damaging Het
Rab3b T A 4: 108,929,452 V133E probably damaging Het
Rnf111 A T 9: 70,476,238 S138T probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Runx1t1 A G 4: 13,835,767 T75A probably benign Het
Ryr2 T G 13: 11,738,356 K1693T probably damaging Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Setd2 T G 9: 110,556,418 probably null Het
Sh3tc2 A G 18: 62,008,575 Y1109C probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc22a2 A G 17: 12,614,826 probably benign Het
Slc35f4 A T 14: 49,313,634 W108R probably damaging Het
Slc4a1ap A G 5: 31,534,180 E440G probably damaging Het
Slc6a4 A G 11: 77,013,375 T219A probably benign Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Svil T G 18: 5,094,640 V1440G possibly damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tbck T C 3: 132,724,916 probably null Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Trdn A G 10: 33,257,095 K314E probably benign Het
Troap T A 15: 99,077,898 C233S probably benign Het
Usp28 T C 9: 49,035,947 M571T probably damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vipr1 C T 9: 121,665,864 P327L possibly damaging Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn1r69 G A 7: 10,580,751 R18W probably benign Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps13b A T 15: 35,430,291 probably benign Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp385c A C 11: 100,630,706 V176G probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Other mutations in Top1mt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Top1mt APN 15 75657143 missense possibly damaging 0.47
IGL02111:Top1mt APN 15 75665706 splice site probably benign
IGL02425:Top1mt APN 15 75676121 missense probably benign
IGL02662:Top1mt APN 15 75668705 missense probably damaging 1.00
R1240:Top1mt UTSW 15 75670067 missense probably damaging 0.99
R1438:Top1mt UTSW 15 75674398 missense probably damaging 1.00
R1732:Top1mt UTSW 15 75666251 critical splice donor site probably null
R3413:Top1mt UTSW 15 75657176 missense probably benign 0.41
R3414:Top1mt UTSW 15 75657176 missense probably benign 0.41
R4677:Top1mt UTSW 15 75664058 missense possibly damaging 0.48
R4784:Top1mt UTSW 15 75657703 missense probably damaging 1.00
R4784:Top1mt UTSW 15 75676031 missense possibly damaging 0.88
R4791:Top1mt UTSW 15 75668625 critical splice donor site probably null
R6339:Top1mt UTSW 15 75665656 missense possibly damaging 0.72
R6723:Top1mt UTSW 15 75667433 missense probably benign 0.01
R6732:Top1mt UTSW 15 75669488 splice site probably null
R6841:Top1mt UTSW 15 75676124 missense probably benign 0.00
R6884:Top1mt UTSW 15 75664044 missense probably benign 0.37
R7024:Top1mt UTSW 15 75667448 missense probably damaging 1.00
R7052:Top1mt UTSW 15 75668711 missense possibly damaging 0.82
R7055:Top1mt UTSW 15 75678674 missense probably benign 0.01
R7273:Top1mt UTSW 15 75664082 missense probably benign 0.27
X0028:Top1mt UTSW 15 75657131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACACTGGTCATGGCTGTG -3'
(R):5'- TTTTCTGAGGCCAGGCTCTG -3'

Sequencing Primer
(F):5'- TCTGTGGCATACGAGCACACTC -3'
(R):5'- GCTCTGCTGCCCCCGTC -3'
Posted On2014-06-30