Incidental Mutation 'R0118:Mrm3'
ID20940
Institutional Source Beutler Lab
Gene Symbol Mrm3
Ensembl Gene ENSMUSG00000038046
Gene Namemitochondrial rRNA methyltransferase 3
SynonymsRnmtl1, 4833420N02Rik, HC90
MMRRC Submission 038404-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R0118 (G1)
Quality Score194
Status Validated (trace)
Chromosome11
Chromosomal Location76243715-76250619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76249955 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 263 (V263E)
Ref Sequence ENSEMBL: ENSMUSP00000042882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040577]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040577
AA Change: V263E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042882
Gene: ENSMUSG00000038046
AA Change: V263E

DomainStartEndE-ValueType
SpoU_sub_bind 124 195 1.99e-5 SMART
Pfam:SpoU_methylase 209 398 2.3e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155526
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 89.3%
  • 20x: 67.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Efficient translation of mitochondrial-derived transcripts requires proper assembly of the large subunit of the mitochondrial ribosome. Central to the biogenesis of this large subunit is the A-loop of mitochondrial 16S rRNA, which is modified by three rRNA methyltransferases located near mtDNA nucleoids. The protein encoded by this gene methylates G(1370) of 16S rRNA, and this modification is necessary for proper ribosomal large subnit assembly. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T C 9: 30,911,744 R343G probably damaging Het
Asxl2 T G 12: 3,496,923 V569G probably damaging Het
Azin2 A C 4: 128,949,637 H85Q probably damaging Het
Cacna1a C T 8: 84,536,083 R324C probably damaging Het
Ccdc151 A T 9: 21,995,057 N224K probably benign Het
Ccr3 C A 9: 124,029,610 Y327* probably null Het
Cers2 T C 3: 95,320,226 F55S probably benign Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cntnap2 T C 6: 45,060,392 probably null Het
Cpn2 T C 16: 30,260,368 R172G probably benign Het
Ctdnep1 T C 11: 69,988,731 probably null Het
Dennd3 T A 15: 73,565,076 Y1051N probably damaging Het
Dmap1 T G 4: 117,676,483 Y196S probably damaging Het
Entpd7 G A 19: 43,704,312 W102* probably null Het
Frem2 A T 3: 53,535,243 C2624* probably null Het
Gdpd3 A G 7: 126,770,993 Y238C probably damaging Het
Gjb3 A G 4: 127,326,658 V27A probably damaging Het
Kat6b T C 14: 21,669,974 F1465L probably damaging Het
Klra17 A T 6: 129,831,589 M227K probably benign Het
Map6 A G 7: 99,317,617 D348G possibly damaging Het
Mapkbp1 T C 2: 120,025,215 S1472P probably benign Het
Megf6 C A 4: 154,254,641 P545Q probably damaging Het
Mertk C T 2: 128,759,166 R357W probably damaging Het
Mesd T A 7: 83,895,627 I104N probably damaging Het
Ndst4 T A 3: 125,611,561 Y488* probably null Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nfs1 T C 2: 156,134,524 H150R probably damaging Het
Olfr1500 A G 19: 13,827,565 F277S possibly damaging Het
Olfr27 T A 9: 39,144,103 M1K probably null Het
Olfr353 A G 2: 36,890,023 M275T probably benign Het
Olfr923 T C 9: 38,827,858 S50P possibly damaging Het
Pcdh8 T C 14: 79,767,408 Y1059C probably damaging Het
Pik3r5 T A 11: 68,490,480 L164Q probably damaging Het
Polr3g T C 13: 81,676,121 probably benign Het
Ppm1e T A 11: 87,231,738 K464N probably benign Het
Rims1 T C 1: 22,346,407 T1037A probably damaging Het
Rpgrip1l A T 8: 91,270,122 I108N probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Spem1 T C 11: 69,821,545 K98E possibly damaging Het
St7l T C 3: 104,889,303 V237A probably damaging Het
Tbc1d16 T C 11: 119,157,816 H337R probably damaging Het
Tbc1d32 T A 10: 56,017,605 I1291F probably benign Het
Tnfaip6 G T 2: 52,043,815 E61* probably null Het
Trib2 A T 12: 15,793,928 W102R probably damaging Het
Uimc1 G T 13: 55,085,644 N66K probably damaging Het
Vmn1r63 T A 7: 5,802,839 T265S probably benign Het
Vps35 G A 8: 85,294,953 T3I probably benign Het
Yeats2 T A 16: 20,156,942 L63* probably null Het
Zfp282 A G 6: 47,892,932 R304G probably benign Het
Other mutations in Mrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Mrm3 APN 11 76244493 missense probably damaging 1.00
IGL02712:Mrm3 APN 11 76243857 missense possibly damaging 0.87
IGL03349:Mrm3 APN 11 76249946 missense probably damaging 1.00
P0026:Mrm3 UTSW 11 76247500 missense probably damaging 1.00
R1174:Mrm3 UTSW 11 76250024 missense probably damaging 1.00
R2066:Mrm3 UTSW 11 76250321 missense probably damaging 1.00
R2114:Mrm3 UTSW 11 76244521 missense possibly damaging 0.49
R3904:Mrm3 UTSW 11 76244286 missense probably benign 0.05
R5591:Mrm3 UTSW 11 76250081 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCACTAGCAGCAATCGGTCTTC -3'
(R):5'- AAGAATCGGCGATCACATGCCCAG -3'

Sequencing Primer
(F):5'- TCTTGGTCCCAGCAATGG -3'
(R):5'- ATGCCCAGTCACGGTCAC -3'
Posted On2013-04-11