Incidental Mutation 'R0118:Uimc1'
ID20946
Institutional Source Beutler Lab
Gene Symbol Uimc1
Ensembl Gene ENSMUSG00000025878
Gene Nameubiquitin interaction motif containing 1
SynonymsD330018D10Rik, D630032M02Rik, Rxrip110, 9430016E08Rik
MMRRC Submission 038404-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R0118 (G1)
Quality Score55
Status Validated (trace)
Chromosome13
Chromosomal Location55027880-55100300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55085644 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 66 (N66K)
Ref Sequence ENSEMBL: ENSMUSP00000097095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026997] [ENSMUST00000099496] [ENSMUST00000127195] [ENSMUST00000148702]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026997
AA Change: N66K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026997
Gene: ENSMUSG00000025878
AA Change: N66K

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
low complexity region 714 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075962
Predicted Effect probably damaging
Transcript: ENSMUST00000099496
AA Change: N66K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097095
Gene: ENSMUSG00000025878
AA Change: N66K

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 1.53e1 SMART
low complexity region 433 446 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124561
Predicted Effect possibly damaging
Transcript: ENSMUST00000127195
AA Change: N66K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122196
Gene: ENSMUSG00000025878
AA Change: N66K

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
low complexity region 714 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133187
Predicted Effect possibly damaging
Transcript: ENSMUST00000148702
AA Change: N66K

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120935
Gene: ENSMUSG00000025878
AA Change: N66K

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
Meta Mutation Damage Score 0.0228 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 89.3%
  • 20x: 67.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with Brca1 (breast cancer 1) in a complex to recognize and repair DNA lesions. This protein binds ubiquitinated lysine 63 of histone H2A and H2AX. This protein may also function as a repressor of transcription. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death due to B-cell lymphomas and abnormal DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T C 9: 30,911,744 R343G probably damaging Het
Asxl2 T G 12: 3,496,923 V569G probably damaging Het
Azin2 A C 4: 128,949,637 H85Q probably damaging Het
Cacna1a C T 8: 84,536,083 R324C probably damaging Het
Ccdc151 A T 9: 21,995,057 N224K probably benign Het
Ccr3 C A 9: 124,029,610 Y327* probably null Het
Cers2 T C 3: 95,320,226 F55S probably benign Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cntnap2 T C 6: 45,060,392 probably null Het
Cpn2 T C 16: 30,260,368 R172G probably benign Het
Ctdnep1 T C 11: 69,988,731 probably null Het
Dennd3 T A 15: 73,565,076 Y1051N probably damaging Het
Dmap1 T G 4: 117,676,483 Y196S probably damaging Het
Entpd7 G A 19: 43,704,312 W102* probably null Het
Frem2 A T 3: 53,535,243 C2624* probably null Het
Gdpd3 A G 7: 126,770,993 Y238C probably damaging Het
Gjb3 A G 4: 127,326,658 V27A probably damaging Het
Kat6b T C 14: 21,669,974 F1465L probably damaging Het
Klra17 A T 6: 129,831,589 M227K probably benign Het
Map6 A G 7: 99,317,617 D348G possibly damaging Het
Mapkbp1 T C 2: 120,025,215 S1472P probably benign Het
Megf6 C A 4: 154,254,641 P545Q probably damaging Het
Mertk C T 2: 128,759,166 R357W probably damaging Het
Mesd T A 7: 83,895,627 I104N probably damaging Het
Mrm3 T A 11: 76,249,955 V263E possibly damaging Het
Ndst4 T A 3: 125,611,561 Y488* probably null Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nfs1 T C 2: 156,134,524 H150R probably damaging Het
Olfr1500 A G 19: 13,827,565 F277S possibly damaging Het
Olfr27 T A 9: 39,144,103 M1K probably null Het
Olfr353 A G 2: 36,890,023 M275T probably benign Het
Olfr923 T C 9: 38,827,858 S50P possibly damaging Het
Pcdh8 T C 14: 79,767,408 Y1059C probably damaging Het
Pik3r5 T A 11: 68,490,480 L164Q probably damaging Het
Polr3g T C 13: 81,676,121 probably benign Het
Ppm1e T A 11: 87,231,738 K464N probably benign Het
Rims1 T C 1: 22,346,407 T1037A probably damaging Het
Rpgrip1l A T 8: 91,270,122 I108N probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Spem1 T C 11: 69,821,545 K98E possibly damaging Het
St7l T C 3: 104,889,303 V237A probably damaging Het
Tbc1d16 T C 11: 119,157,816 H337R probably damaging Het
Tbc1d32 T A 10: 56,017,605 I1291F probably benign Het
Tnfaip6 G T 2: 52,043,815 E61* probably null Het
Trib2 A T 12: 15,793,928 W102R probably damaging Het
Vmn1r63 T A 7: 5,802,839 T265S probably benign Het
Vps35 G A 8: 85,294,953 T3I probably benign Het
Yeats2 T A 16: 20,156,942 L63* probably null Het
Zfp282 A G 6: 47,892,932 R304G probably benign Het
Other mutations in Uimc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Uimc1 APN 13 55034911 missense probably benign 0.05
IGL01655:Uimc1 APN 13 55028704 missense probably benign 0.11
IGL01867:Uimc1 APN 13 55075401 missense probably benign
IGL02512:Uimc1 APN 13 55040618 missense possibly damaging 0.66
IGL02704:Uimc1 APN 13 55030959 missense probably benign 0.01
PIT4382001:Uimc1 UTSW 13 55031015 missense probably benign 0.00
PIT4486001:Uimc1 UTSW 13 55075568 missense probably damaging 0.99
R0349:Uimc1 UTSW 13 55075991 missense probably benign 0.11
R0441:Uimc1 UTSW 13 55093219 missense probably damaging 1.00
R0634:Uimc1 UTSW 13 55060266 missense possibly damaging 0.66
R0834:Uimc1 UTSW 13 55076409 critical splice acceptor site probably null
R1175:Uimc1 UTSW 13 55028602 missense possibly damaging 0.92
R2243:Uimc1 UTSW 13 55050739 critical splice donor site probably null
R2566:Uimc1 UTSW 13 55075804 missense probably damaging 1.00
R4435:Uimc1 UTSW 13 55075823 missense probably damaging 0.96
R4622:Uimc1 UTSW 13 55077494 missense probably damaging 1.00
R4935:Uimc1 UTSW 13 55093185 missense probably damaging 0.97
R5140:Uimc1 UTSW 13 55075517 missense probably damaging 1.00
R5466:Uimc1 UTSW 13 55075848 missense probably damaging 1.00
R6395:Uimc1 UTSW 13 55040576 missense possibly damaging 0.66
R6955:Uimc1 UTSW 13 55040546 missense possibly damaging 0.86
R7040:Uimc1 UTSW 13 55075454 intron probably null
R7106:Uimc1 UTSW 13 55050815 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGCTGAAAGCTGCACTCTGTCTTC -3'
(R):5'- CTTGGCAAAGCGCATGTTCCTC -3'

Sequencing Primer
(F):5'- tcccaacattacccagcag -3'
(R):5'- AGAGATTCGTATCTTTGCGACC -3'
Posted On2013-04-11