Incidental Mutation 'R1885:Apobec3'
ID209487
Institutional Source Beutler Lab
Gene Symbol Apobec3
Ensembl Gene ENSMUSG00000009585
Gene Nameapolipoprotein B mRNA editing enzyme, catalytic polypeptide 3
SynonymsRfv3, Gm20117, CEM15, Rfv-3
MMRRC Submission 039906-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1885 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79891659-79915906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79897705 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 82 (H82L)
Ref Sequence ENSEMBL: ENSMUSP00000135079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023054] [ENSMUST00000109620] [ENSMUST00000165537] [ENSMUST00000175714] [ENSMUST00000175752] [ENSMUST00000176325] [ENSMUST00000176868] [ENSMUST00000176904] [ENSMUST00000177006] [ENSMUST00000177098] [ENSMUST00000177350] [ENSMUST00000177483] [ENSMUST00000230135] [ENSMUST00000230741]
Predicted Effect probably benign
Transcript: ENSMUST00000023054
SMART Domains Protein: ENSMUSP00000023054
Gene: ENSMUSG00000009585

DomainStartEndE-ValueType
Pfam:APOBEC_N 1 99 6.5e-22 PFAM
Pfam:APOBEC_C 37 91 2.8e-23 PFAM
Pfam:APOBEC_N 106 276 4.4e-28 PFAM
Pfam:APOBEC_C 215 268 1.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109620
AA Change: H71L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105249
Gene: ENSMUSG00000009585
AA Change: H71L

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 198 6.5e-37 PFAM
Pfam:APOBEC_C 136 190 4.9e-23 PFAM
low complexity region 203 213 N/A INTRINSIC
Pfam:APOBEC_N 238 408 1.1e-27 PFAM
Pfam:APOBEC_C 347 400 2.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165537
AA Change: H71L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132391
Gene: ENSMUSG00000009585
AA Change: H71L

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 198 5.4e-37 PFAM
Pfam:APOBEC_C 136 190 4.3e-23 PFAM
Pfam:APOBEC_N 205 375 9e-28 PFAM
Pfam:APOBEC_C 314 367 2.3e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000175714
AA Change: H82L
SMART Domains Protein: ENSMUSP00000135027
Gene: ENSMUSG00000009585
AA Change: H82L

DomainStartEndE-ValueType
Pfam:APOBEC_N 37 206 1.1e-57 PFAM
Pfam:APOBEC_C 148 199 2e-22 PFAM
low complexity region 214 224 N/A INTRINSIC
Pfam:APOBEC_N 253 416 7.6e-33 PFAM
Pfam:APOBEC_C 359 409 3.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175752
AA Change: H82L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135358
Gene: ENSMUSG00000009585
AA Change: H82L

DomainStartEndE-ValueType
Pfam:APOBEC_N 32 209 7.9e-37 PFAM
Pfam:APOBEC_C 147 201 6.3e-23 PFAM
Pfam:APOBEC_N 216 386 1.3e-27 PFAM
Pfam:APOBEC_C 325 378 3.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175849
Predicted Effect probably damaging
Transcript: ENSMUST00000176325
AA Change: H82L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134838
Gene: ENSMUSG00000009585
AA Change: H82L

DomainStartEndE-ValueType
Pfam:APOBEC_N 32 209 9e-37 PFAM
Pfam:APOBEC_C 147 201 6.8e-23 PFAM
low complexity region 214 224 N/A INTRINSIC
Pfam:APOBEC_N 249 419 1.5e-27 PFAM
Pfam:APOBEC_C 358 411 3.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176823
Predicted Effect probably benign
Transcript: ENSMUST00000176868
Predicted Effect probably benign
Transcript: ENSMUST00000176904
SMART Domains Protein: ENSMUSP00000135502
Gene: ENSMUSG00000009585

DomainStartEndE-ValueType
Pfam:APOBEC_N 1 84 7.4e-21 PFAM
Pfam:APOBEC_C 37 85 2.7e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177006
AA Change: T33S
Predicted Effect probably damaging
Transcript: ENSMUST00000177098
AA Change: H82L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135079
Gene: ENSMUSG00000009585
AA Change: H82L

DomainStartEndE-ValueType
Pfam:APOBEC_N 31 209 6.8e-37 PFAM
Pfam:APOBEC_C 147 201 6e-23 PFAM
Pfam:APOBEC_N 216 386 1.2e-27 PFAM
Pfam:APOBEC_C 325 378 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177350
SMART Domains Protein: ENSMUSP00000134938
Gene: ENSMUSG00000009585

DomainStartEndE-ValueType
Pfam:APOBEC_N 1 99 1.6e-22 PFAM
Pfam:APOBEC_C 37 91 9.8e-24 PFAM
low complexity region 104 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177483
SMART Domains Protein: ENSMUSP00000135011
Gene: ENSMUSG00000009585

DomainStartEndE-ValueType
Pfam:APOBEC_N 1 99 1.3e-22 PFAM
Pfam:APOBEC_C 37 91 8.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230410
Predicted Effect probably benign
Transcript: ENSMUST00000230741
Coding Region Coverage
  • 1x: 97.0%
  • 3x: 96.1%
  • 10x: 92.7%
  • 20x: 85.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. A hybrid gene results from the deletion of approximately 29.5 kb of sequence between this gene, APOBEC3B, and the adjacent gene APOBEC3A. The breakpoints of the deletion are within the two genes, so the deletion allele is predicted to have the promoter and coding region of APOBEC3A, but the 3' UTR of APOBEC3B. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele display more rapid and extensive spread of viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acox2 C T 14: 8,248,102 M393I probably benign Het
Adcy10 A G 1: 165,570,808 I1491M probably benign Het
Adcy3 T A 12: 4,134,951 V209E probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Ap2b1 T A 11: 83,390,735 N822K probably damaging Het
Atg9b A T 5: 24,388,254 W384R probably damaging Het
Atp8a1 A G 5: 67,747,318 V506A possibly damaging Het
Atxn1 G T 13: 45,567,804 A205D probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B4galnt3 T C 6: 120,223,640 E223G probably damaging Het
Brip1 C A 11: 86,138,815 G631V probably damaging Het
C530008M17Rik A G 5: 76,856,742 T317A unknown Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Caprin2 A T 6: 148,877,885 probably null Het
Ccdc80 A C 16: 45,096,720 D613A probably benign Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cebpz A T 17: 78,932,116 D625E probably benign Het
Coq6 C A 12: 84,372,464 N388K probably damaging Het
D430041D05Rik T C 2: 104,230,455 M1365V probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dpysl4 T G 7: 139,096,807 V391G probably damaging Het
Dyrk4 G T 6: 126,877,181 Q550K probably benign Het
Epas1 A G 17: 86,805,295 D107G probably damaging Het
Esrp2 A G 8: 106,131,821 V636A possibly damaging Het
Etl4 T A 2: 20,743,984 Y176N probably damaging Het
Etnppl T C 3: 130,629,462 V264A probably benign Het
Fer T A 17: 64,138,914 V790D probably damaging Het
Gdpd5 G A 7: 99,459,997 V575I probably benign Het
Gif G A 19: 11,752,324 A216T probably benign Het
Gipc3 T C 10: 81,341,347 I130V probably benign Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Iqsec3 G A 6: 121,428,367 probably benign Het
Kdm5d G T Y: 940,781 probably null Het
Kl A G 5: 150,953,494 R260G possibly damaging Het
Kras T C 6: 145,232,117 E143G probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Ksr1 T C 11: 79,036,521 T329A probably damaging Het
March6 A G 15: 31,502,806 V83A probably benign Het
Mettl2 T C 11: 105,131,620 I212T possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mlh1 C A 9: 111,258,556 S24I probably benign Het
Mmel1 G A 4: 154,890,876 R424Q possibly damaging Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Myh3 A G 11: 67,086,627 K368E probably benign Het
Myo16 T A 8: 10,322,656 N118K probably damaging Het
Myo5c A G 9: 75,249,761 S160G probably damaging Het
Nat1 A T 8: 67,491,001 I13F probably damaging Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nwd1 T C 8: 72,704,994 S1207P probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1390 T C 11: 49,340,835 L101P probably damaging Het
Olfr153 T C 2: 87,532,824 S264P probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Paqr8 A T 1: 20,935,480 H286L probably damaging Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pes1 A G 11: 3,969,482 K52E probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Robo2 T C 16: 73,916,145 D1283G probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Slc2a4 C T 11: 69,945,007 V339I probably benign Het
Slc39a6 G A 18: 24,601,482 probably null Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Snx33 T C 9: 56,925,837 H316R probably benign Het
Spata31d1a T G 13: 59,702,007 D769A probably damaging Het
Stmn2 A T 3: 8,541,904 E28V probably damaging Het
Syt9 A G 7: 107,436,529 D251G probably damaging Het
Tjap1 T C 17: 46,262,421 T37A probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tprg A G 16: 25,412,891 T206A probably benign Het
Tsta3 G T 15: 75,926,989 T123N possibly damaging Het
Ttc37 A T 13: 76,113,047 R112S probably benign Het
Ttc37 A G 13: 76,130,235 Q556R probably benign Het
Ubqlnl A T 7: 104,150,065 M75K possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r12 C T 5: 109,092,076 G207E probably damaging Het
Xrn2 T G 2: 147,049,361 L697* probably null Het
Zfp764 A G 7: 127,405,039 F307L probably benign Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Zranb2 A T 3: 157,543,156 probably null Het
Other mutations in Apobec3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02529:Apobec3 APN 15 79897687 unclassified probably benign
R1863:Apobec3 UTSW 15 79897867 missense possibly damaging 0.58
R3815:Apobec3 UTSW 15 79899100 missense possibly damaging 0.95
R4175:Apobec3 UTSW 15 79895452 missense probably damaging 1.00
R4677:Apobec3 UTSW 15 79895512 missense probably damaging 0.99
R4780:Apobec3 UTSW 15 79899024 missense possibly damaging 0.84
R5540:Apobec3 UTSW 15 79897919 missense probably benign 0.01
R5830:Apobec3 UTSW 15 79899067 missense possibly damaging 0.84
R5945:Apobec3 UTSW 15 79897846 missense probably damaging 1.00
R6535:Apobec3 UTSW 15 79897749 makesense probably null
X0066:Apobec3 UTSW 15 79905524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGCAGACAGATAACCAGCC -3'
(R):5'- AGATGTCCAGGCTCAGGTTG -3'

Sequencing Primer
(F):5'- CTTCAACAGGGCTCAGAGTGCTAG -3'
(R):5'- GTGGTGTGTAGCCAGGAACC -3'
Posted On2014-06-30