Incidental Mutation 'R1885:Slc39a6'
ID209498
Institutional Source Beutler Lab
Gene Symbol Slc39a6
Ensembl Gene ENSMUSG00000024270
Gene Namesolute carrier family 39 (metal ion transporter), member 6
SynonymsErmelin
MMRRC Submission 039906-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R1885 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location24579881-24603817 bp(-) (GRCm38)
Type of Mutationunclassified (3 bp from exon)
DNA Base Change (assembly) G to A at 24601482 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025120] [ENSMUST00000070726] [ENSMUST00000152504] [ENSMUST00000154205]
Predicted Effect probably benign
Transcript: ENSMUST00000025120
SMART Domains Protein: ENSMUSP00000025120
Gene: ENSMUSG00000024271

DomainStartEndE-ValueType
WD40 47 91 1.06e-3 SMART
WD40 94 143 2.24e-2 SMART
WD40 196 237 4.69e-5 SMART
WD40 271 319 2.44e-3 SMART
Blast:WD40 329 368 1e-20 BLAST
WD40 376 415 2.12e-3 SMART
WD40 429 467 1.71e1 SMART
WD40 556 600 7.43e-1 SMART
WD40 603 642 1.93e-6 SMART
WD40 661 697 1.55e-5 SMART
Blast:WD40 709 753 7e-21 BLAST
WD40 766 825 1.92e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000070726
AA Change: A50V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064667
Gene: ENSMUSG00000024270
AA Change: A50V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 94 141 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
Pfam:Zip 332 753 3e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128106
Predicted Effect probably null
Transcript: ENSMUST00000152504
Predicted Effect probably benign
Transcript: ENSMUST00000154205
SMART Domains Protein: ENSMUSP00000122151
Gene: ENSMUSG00000024270

DomainStartEndE-ValueType
Pfam:Zip 48 433 2e-94 PFAM
Coding Region Coverage
  • 1x: 97.0%
  • 3x: 96.1%
  • 10x: 92.7%
  • 20x: 85.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A6 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele do not display any gross skin abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acox2 C T 14: 8,248,102 M393I probably benign Het
Adcy10 A G 1: 165,570,808 I1491M probably benign Het
Adcy3 T A 12: 4,134,951 V209E probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Ap2b1 T A 11: 83,390,735 N822K probably damaging Het
Apobec3 A T 15: 79,897,705 H82L probably damaging Het
Atg9b A T 5: 24,388,254 W384R probably damaging Het
Atp8a1 A G 5: 67,747,318 V506A possibly damaging Het
Atxn1 G T 13: 45,567,804 A205D probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B4galnt3 T C 6: 120,223,640 E223G probably damaging Het
Brip1 C A 11: 86,138,815 G631V probably damaging Het
C530008M17Rik A G 5: 76,856,742 T317A unknown Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Caprin2 A T 6: 148,877,885 probably null Het
Ccdc80 A C 16: 45,096,720 D613A probably benign Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cebpz A T 17: 78,932,116 D625E probably benign Het
Coq6 C A 12: 84,372,464 N388K probably damaging Het
D430041D05Rik T C 2: 104,230,455 M1365V probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dpysl4 T G 7: 139,096,807 V391G probably damaging Het
Dyrk4 G T 6: 126,877,181 Q550K probably benign Het
Epas1 A G 17: 86,805,295 D107G probably damaging Het
Esrp2 A G 8: 106,131,821 V636A possibly damaging Het
Etl4 T A 2: 20,743,984 Y176N probably damaging Het
Etnppl T C 3: 130,629,462 V264A probably benign Het
Fer T A 17: 64,138,914 V790D probably damaging Het
Gdpd5 G A 7: 99,459,997 V575I probably benign Het
Gif G A 19: 11,752,324 A216T probably benign Het
Gipc3 T C 10: 81,341,347 I130V probably benign Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Iqsec3 G A 6: 121,428,367 probably benign Het
Kdm5d G T Y: 940,781 probably null Het
Kl A G 5: 150,953,494 R260G possibly damaging Het
Kras T C 6: 145,232,117 E143G probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Ksr1 T C 11: 79,036,521 T329A probably damaging Het
March6 A G 15: 31,502,806 V83A probably benign Het
Mettl2 T C 11: 105,131,620 I212T possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mlh1 C A 9: 111,258,556 S24I probably benign Het
Mmel1 G A 4: 154,890,876 R424Q possibly damaging Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Myh3 A G 11: 67,086,627 K368E probably benign Het
Myo16 T A 8: 10,322,656 N118K probably damaging Het
Myo5c A G 9: 75,249,761 S160G probably damaging Het
Nat1 A T 8: 67,491,001 I13F probably damaging Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nwd1 T C 8: 72,704,994 S1207P probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1390 T C 11: 49,340,835 L101P probably damaging Het
Olfr153 T C 2: 87,532,824 S264P probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Paqr8 A T 1: 20,935,480 H286L probably damaging Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pes1 A G 11: 3,969,482 K52E probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Robo2 T C 16: 73,916,145 D1283G probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Slc2a4 C T 11: 69,945,007 V339I probably benign Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Snx33 T C 9: 56,925,837 H316R probably benign Het
Spata31d1a T G 13: 59,702,007 D769A probably damaging Het
Stmn2 A T 3: 8,541,904 E28V probably damaging Het
Syt9 A G 7: 107,436,529 D251G probably damaging Het
Tjap1 T C 17: 46,262,421 T37A probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tprg A G 16: 25,412,891 T206A probably benign Het
Tsta3 G T 15: 75,926,989 T123N possibly damaging Het
Ttc37 A T 13: 76,113,047 R112S probably benign Het
Ttc37 A G 13: 76,130,235 Q556R probably benign Het
Ubqlnl A T 7: 104,150,065 M75K possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r12 C T 5: 109,092,076 G207E probably damaging Het
Xrn2 T G 2: 147,049,361 L697* probably null Het
Zfp764 A G 7: 127,405,039 F307L probably benign Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Zranb2 A T 3: 157,543,156 probably null Het
Other mutations in Slc39a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Slc39a6 APN 18 24589745 critical splice donor site probably null
IGL01412:Slc39a6 APN 18 24585356 missense probably damaging 1.00
IGL02182:Slc39a6 APN 18 24601290 missense probably damaging 0.99
IGL02332:Slc39a6 APN 18 24589823 missense probably benign 0.22
IGL02648:Slc39a6 APN 18 24582367 missense probably damaging 1.00
R0066:Slc39a6 UTSW 18 24599269 missense probably damaging 1.00
R0066:Slc39a6 UTSW 18 24599269 missense probably damaging 1.00
R0729:Slc39a6 UTSW 18 24601470 missense probably benign 0.00
R1128:Slc39a6 UTSW 18 24585292 missense probably damaging 1.00
R1621:Slc39a6 UTSW 18 24600889 missense probably benign 0.08
R1799:Slc39a6 UTSW 18 24585467 missense probably benign 0.00
R1800:Slc39a6 UTSW 18 24585202 missense probably damaging 1.00
R4159:Slc39a6 UTSW 18 24597828 missense possibly damaging 0.88
R4809:Slc39a6 UTSW 18 24585474 nonsense probably null
R4903:Slc39a6 UTSW 18 24597868 missense probably damaging 1.00
R4994:Slc39a6 UTSW 18 24596294 missense probably damaging 1.00
R5352:Slc39a6 UTSW 18 24601036 missense probably benign 0.00
R5398:Slc39a6 UTSW 18 24597879 missense probably damaging 1.00
R5832:Slc39a6 UTSW 18 24601612 missense possibly damaging 0.81
R6182:Slc39a6 UTSW 18 24600956 missense probably benign 0.16
R6853:Slc39a6 UTSW 18 24599319 missense possibly damaging 0.71
X0065:Slc39a6 UTSW 18 24585375 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCATGGTCCGAGTGATGCTC -3'
(R):5'- TCAGTTTTCAGCATGAGGTTTCTTC -3'

Sequencing Primer
(F):5'- CTCGTGGTCAGCATGATGC -3'
(R):5'- GAAATATGGTAAAGCATTTCCCCC -3'
Posted On2014-06-30